Cart 25 Product Products 3 083,94 € (empty)
-
-
-
-
1 x PEA15-phos...113,40 € -
-
-
1 x NF2-neurof...113,40 € -
1 x NHP2-NHP2...113,40 € -
1 x LOC440248-...121,50 € -
1 x CCNC-cycli...121,50 € -
1 x PSME4-prot...113,40 € -
1 x ZNF385C-zi...113,40 € -
-
-
-
1 x ELF2-E74-l...121,50 € -
-
1 x BAALC-brai...113,40 € -
1 x TRAPPC10-t...121,50 € -
1 x GGT6-gamma...121,50 € -
-
1 x ALG12-aspa...121,50 € -
1 x APOC2-apol...113,40 € -
1 x TSPAN17-te...121,50 € -
No products
265,00 € DAP Shipping
3 348,94 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 25 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 083,94 €
Total shipping (tax excl.) 265,00 €
Total (tax excl.) 3 348,94 €
View larger 
Data sheet of TM4SF5-transmembrane 4 L six family member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TM4SF5-transmembrane 4 L six family member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069519 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TM4SF5 |
| Origin species: | Human |
| Product name: | TM4SF5-transmembrane 4 L six family member 5 Gene |
| Size: | 2ug |
| Accessions: | BC069519 |
| Gene id: | 9032 |
| Gene description: | transmembrane 4 L six family member 5 |
| Synonyms: | transmembrane 4 L6 family member 5; tetraspan transmembrane protein L6H; transmembrane 4 superfamily member 5; transmembrane 4 L six family member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgtacgggaaaatgtgcccgctgtgtggggctctccctcattaccctctgcctcgtctgcattgtggccaacgccctcctgctggtacctaatggggagacctcctggaccaacaccaaccatctcagcttgcaagtctggctcatgggcggcttcattggcgggggcctaatggtactgtgtccagggattgcagccgttcgggcagggggcaagggctgctgtggtgctgggtgctgtggaaaccgctgcaggatgctgcgctcggtcttctcctcggcgttcggggtgcttggtgccatctactgcctctcggtgtctggagctgggctccgaaatggacccagatgcttaatgaacggcgagtggggctaccacttcgaagacaccgcgggagcttacttgctcaaccgcactctatgggatcggtgcgaggcgccccctcgcgtggtcccctggaatgtgacgctcttctcgctgctggtggccgcctcctgcctggagatagtactgtgtgggatccagctggtgaacgcgaccattggtgtcttctgcggcgattgcaggaaaaaacaggacacccctcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - immunoglobulin superfamily, member 10 - BCL2-like 11 (apoptosis facilitator) - solute carrier family 25, member 34 - chromosome 1 open reading frame 109 |