KCNN3-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene View larger

KCNN3-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNN3-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KCNN3-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC042147
Product type: DNA & cDNA
Ncbi symbol: KCNN3
Origin species: Human
Product name: KCNN3-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene
Size: 2ug
Accessions: BC042147
Gene id: 3782
Gene description: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms: KCa2.3; SK3; SKCA3; hSK3; small conductance calcium-activated potassium channel protein 3; SKCa 3; potassium channel, calcium activated intermediate/small conductance subfamily N alpha, member 3; potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3; small conductance calcium-activated potassium channel 3; potassium calcium-activated channel subfamily N member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagacctataaaggactccatgttttcgttggccctgaaatgccttatcagtctgtccaccatcatccttttgggcttgatcatcgcctaccacacacgtgaagtccagctcttcgtgatcgacaatggcgcggatgactggcggatagccatgacctacgagcgcatcctgtacatcagcctggagatgctggtgtgcgccatccaccccattcctggcgagtacaagttcttctggacggcacgcctggccttctcctacacaccctcccgggcggaggccgatgtggacatcatcctgtctatccccatgttcctgcgcctgtacctgatcgcccgagtcatgctgctgcacagcaagctcttcaccgatgcctcgtcccgcagcatcggggccctcaacaagatcaacttcaacacccgctttgtcatgaagacgctcatgaccatctgccctggcactgtgctgctcgtgttcagcatctctctgtggatcattgctgcctggaccgtccgtgtctgtgaaaggtaccatgaccagcaggacgtaactagtaactttctgggtgccatgtggctcatctccatcacattcctttccattggttatggggacatggtgccccacacatactgtgggaaaggtgtctgtctcctcactggcatcatgggtgcaggctgcactgcccttgtggtggccgtggtggcccgaaagctggaactcaccaaagcggagaagcacgttcataacttcatgatggacactcagctcaccaagcggatcaagaatgctgcagccaatgtccttcgggaaacatggttaatctataaacacacaaagctgctaaagaagattgaccatgccaaagtgaggaaacaccagaggaagttcctccaagctatccaccagttgaggagcgtcaagatggaacagaggaagctgagtgaccaagccaacactctggtggacctttccaagatgcagaatgtcatgtatgacttaatcacagaactcaatgaccggagcgaagacctggagaagcagattggcagcctggagtcgaagctggagcatctcaccgccagcttcaactccctgccgctgctcatcgccgacaccctgcgccagcagcagcagcagctcctgtctgccatcatcgaggcccggggtgtcagcgtggcagtgggcaccacccacaccccaatctccgatagccccattggggtcagctccacctccttcccgaccccgtacacaagttcaagcagttgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
- heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)
- proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2)
- ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle

Buy KCNN3-potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene now

Add to cart