Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMB9-proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) Gene
PTXBC065513
New product
Data sheet of PSMB9-proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMB9-proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC065513 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMB9 |
| Origin species: | Human |
| Product name: | PSMB9-proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) Gene |
| Size: | 2ug |
| Accessions: | BC065513 |
| Gene id: | 5698 |
| Gene description: | proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) |
| Synonyms: | LMP2; PSMB6i; RING12; beta1i; proteasome subunit beta type-9; large multifunctional peptidase 2; low molecular mass protein 2; macropain chain 7; multicatalytic endopeptidase complex chain 7; proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2); proteasome catalytic subunit 1i; proteasome chain 7; proteasome subunit beta 6i; proteasome subunit beta-1i; proteasome-related gene 2; really interesting new gene 12 protein; proteasome subunit beta 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcgggcgggagcaccaaccggggacttaccccgggcgggagaagtccacaccgggaccaccatcatggcagtggagtttgacgggggcgttgtgatgggttctgattcccgagtgtctgcaggcgaggcggtggtgaaccgagtgtttgacaagctgtccccgctgcacgagcgcatctactgtgcactctctggttcagctgctgatgcccaagccgtggccgacatggccgcctaccagctggagctccatgggatagaactggaggaacctccacttgttttggctgctgcaaatgtggtgagaaatatcagctataaatatcgagaggacttgtctgcacatctcatggtagctggctgggaccaacgtgaaggaggtcaggtatatggaaccctgggaggaatgctgactcgacagccttttgccattggtggctccggcagcacctttatctatggttatgtggatgcagcatataagccaggcatgtctcccgaggagtgcaggcgcttcaccacagacgctattgctctggccatgagccgggatggctcaagcgggggtgtcatctacctggtcactattacagctgccggtgtggaccatcgagtcatcttgggcaatgaactgccaaaattctatgatgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle - potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1 - solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 |