Login to display prices
Login to display prices
EPB49-erythrocyte membrane protein band 4.9 (dematin) Gene View larger

EPB49-erythrocyte membrane protein band 4.9 (dematin) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EPB49-erythrocyte membrane protein band 4.9 (dematin) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EPB49-erythrocyte membrane protein band 4.9 (dematin) Gene

Proteogenix catalog: PTXBC052805
Ncbi symbol: EPB49
Product name: EPB49-erythrocyte membrane protein band 4.9 (dematin) Gene
Size: 2ug
Accessions: BC052805
Gene id: 2039
Gene description: erythrocyte membrane protein band 4.9 (dematin)
Synonyms: EPB49; DMT; dematin; erythrocyte membrane protein band 4.9 (dematin); dematin actin binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacggctgcagaagcaaccacttacctcccccgggagcgtgagcccctcccgagattccagtgtgcctggctctccctccagcatcgtggccaagatggacaatcaggtgctgggctacaaggacctggctgccatccccaaggacaaggccatcctggacatcgagcggcccgacctcatgatctacgagcctcactttacttattccctcctggaacacgtggagctgcctcgcagccgcgagcgctcgctgtcacccaaatccacatcccccccaccatccccagaggtgtgggcggacagccggtcgcctggaatcatctctcaggcctcggcccccagaaccactggaaccccccggaccagcctgccccatttccaccaccctgagacctcccgcccagattccaacatctacaagaagcctcccatctataagcagagagagtccgtgggaggcagccctcagaccaagcacctcatcgaggatctcatcatcgagtcatccaagtttcctgcagcccagcccccagaccccaaccagccagccaaaatcgaaaccgactactggccatgccccccgtctctggctgttgtggagacagaatggaggaagcggaaggcgtctcggaggggagcagaggaagaggaggaggaggaagatgacgactctggagaggagatgaaggctctcagggagcgtcagagagaggaactcagtaaggttacttccaacttgggaaagatgatcttgaaagaagagatggaaaagtcattgccgatccgaaggaaaacccgctctctgcctgaccggacacccttccatacctccttgcaccagggaacgtctaaatcttcctctctccccgcctatggcaggaccaccctgagccggctacagtccacagagttcagcccatcagggagtgagactggaagcccaggcctgcagatctatccctatgaaatgctagtggtgaccaacaaggggcgaaccaagctgccaccgggggtggatcggatgcggcttgagaggcatctgtctgccgaggacttctcaagggtatttgccatgtcccctgaagagtttggcaagctggctctgtggaagcggaatgagctcaagaagaaggcctctctcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: