Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NR1I3-nuclear receptor subfamily 1, group I, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NR1I3-nuclear receptor subfamily 1, group I, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069626 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NR1I3 |
| Origin species: | Human |
| Product name: | NR1I3-nuclear receptor subfamily 1, group I, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC069626 |
| Gene id: | 9970 |
| Gene description: | nuclear receptor subfamily 1, group I, member 3 |
| Synonyms: | CAR; CAR1; MB67; nuclear receptor subfamily 1 group I member 3; constitutive activator of retinoid response; constitutive active receptor; constitutive active response; constitutive androstane nuclear receptor variant 2; constitutive androstane nuclear receptor variant 3; constitutive androstane nuclear receptor variant 4; constitutive androstane nuclear receptor variant 5; orphan nuclear hormone receptor; orphan nuclear receptor MB67 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagtagggaagatgagctgaggaactgtgtggtatgtggggaccaagccacaggctaccactttaatgcgctgacttgtgagggctgcaagggtttcttcaggagaacagtcagcaaaagcattggtcccacctgcccctttgctggaagctgtgaagtcagcaagactcagaggcgccactgcccagcctgcaggttgcagaagtgcttagatgctggcatgaggaaagacatgatactgtcggcagaagccctggcattgcggcgagcaaagcaggcccagcggcgggcacagcaaacacctgtgcaactgagtaaggagcaagaagagctgatccggacactcctgggggcccacacccgccacatgggcaccatgtttgaacagtttgtgcagtttaggcctccagctcatctgttcatccatcaccagcccttgcccaccctggcccctgtgctgcctctggtcacacacttcgcagacatcaacactttcatggtactgcaagtcatcaagtttactaaggacctgcctgtcttccgttccctgcccattgaagaccagatctcccttctcaagggagcagctgtggaaatctgtcacatcgtactcaataccactttctgtctccaaacacaaaacttcctctgcgggcctcttcgctacacaattgaagatggagcccgtgtatctcccacagtggggttccaggtagagtttttggagttgctctttcacttccatggaacactacgaaaactgcagctccaagagcctgagtatgtgctcttggctgccatggccctcttctctcctgaccgacctggagttacccagagagatgagattgatcagctgcaagaggagatggcactgactctgcaaagctacatcaagggccagcagcgaaggccccgggatcggtttctgtatgcgaagttgctaggcctgctggctgagctccggagcattaatgaggcctacgggtaccaaatccagcacatccagggcctgtctgccatgatgccgctgctccaggagatctgcagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Williams-Beuren syndrome chromosome region 17 - progestin and adipoQ receptor family member VII - heterogeneous nuclear ribonucleoprotein L-like - amiloride-sensitive cation channel 4, pituitary |