DNAJC7-DnaJ (Hsp40) homolog, subfamily C, member 7 Gene View larger

DNAJC7-DnaJ (Hsp40) homolog, subfamily C, member 7 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJC7-DnaJ (Hsp40) homolog, subfamily C, member 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJC7-DnaJ (Hsp40) homolog, subfamily C, member 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003601
Product type: DNA & cDNA
Ncbi symbol: DNAJC7
Origin species: Human
Product name: DNAJC7-DnaJ (Hsp40) homolog, subfamily C, member 7 Gene
Size: 2ug
Accessions: BC003601
Gene id: 7266
Gene description: DnaJ (Hsp40) homolog, subfamily C, member 7
Synonyms: DJ11; DJC7; TPR2; TTC2; dnaJ homolog subfamily C member 7; DnaJ (Hsp40) homolog, subfamily C, member 7; TPR repeat protein 2; tetratricopeptide repeat domain 2; tetratricopeptide repeat protein 2; DnaJ heat shock protein family (Hsp40) member C7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtcctaaaaatgctagctattatggtaatcgagcagccaccttgatgatgcttggaaggttccgggaagctcttggagatgcacaacagtcagtgaggttggatgacagttttgtccggggacatctacgagagggcaagtgccacctctctctggggaatgccatggcagcatgtcgcagcttccagagagccctagaactggatcataaaaatgctcaggcacaacaagagttcaagaatgctaatgcagtcatggaatatgagaaaatagcagaaacagattttgagaagcgagattttcggaaggttgttttctgcatggaccgtgccctagaatttgcccctgcctgccatcgcttcaaaatcctcaaggcagaatgtttagcaatgctgggtcgttatccagaagcacagtctgtggctagtgacattctacgaatggattccaccaatgcagatgctctgtatgtacgaggtctttgcctttattacgaagattgtattgagaaggcagttcagtttttcgtacaggctctcaggatggctcctgaccacgagaaggcctgcattgcctgcagaaatgccaaagcactcaaagcaaagaaagaagatgggaataaagcatttaaggaaggaaattacaaactagcatatgaactgtacacagaagccctggggatagaccccaacaatataaaaacaaatgctaaactctactgtaatcggggtacggttaattccaagcttaggaaactagatgatgcaatagaagactgcacaaatgcagtgaagcttgatgacacttacataaaagcctacttgagaagagctcagtgttacatggacacagaacagtatgaagaagcagtacgagactatgaaaaagtataccagacagagaaaacaaaagaacacaaacagctcctaaaaaatgcgcagctggaactgaagaagagtaagaggaaagattactacaagattctaggagtggacaagaatgcctctgaggacgagatcaagaaagcttatcggaaacgggccttgatgcaccatccagatcggcatagtggagccagtgctgaggttcagaaggaggaggagaagaagttcaaggaagttggagaggcctttactatcctctctgatcccaagaaaaagactcgctatgacagtggacaggacctagatgaggagggcatgaatatgggtgattttgatccaaacaatatcttcaaggcattctttggcggtcctggcggcttcagctttgaagcatctggtccagggaatttcttttttcaatttggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aldehyde dehydrogenase 3 family, member B1
- p53-regulated apoptosis-inducing protein 1
- actin filament associated protein 1-like 2
- myosin, heavy chain 7B, cardiac muscle, beta

Buy DNAJC7-DnaJ (Hsp40) homolog, subfamily C, member 7 Gene now

Add to cart