Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MYH7B-myosin, heavy chain 7B, cardiac muscle, beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MYH7B-myosin, heavy chain 7B, cardiac muscle, beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069327 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYH7B |
| Origin species: | Human |
| Product name: | MYH7B-myosin, heavy chain 7B, cardiac muscle, beta Gene |
| Size: | 2ug |
| Accessions: | BC069327 |
| Gene id: | 57644 |
| Gene description: | myosin, heavy chain 7B, cardiac muscle, beta |
| Synonyms: | MHC14; MYH14; myosin-7B; U937-associated antigen; antigen MLAA-21; myosin heavy chain 7B, cardiac muscle beta isoform; myosin, heavy chain 7B, cardiac muscle, beta; myosin, heavy polypeptide 7B, cardiac muscle, beta; slow A MYH14; myosin heavy chain 7B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgtgagtgaacttggggagtctgcccgctacctccgccagggctaccaggagatgacgaaggtgcacactatcccatgggacgggaagaagcgagtctgggtgcctgatgaacaggacgcctacgtggaggccgaggtcaagtcggaggctaccgggggcagagtcaccgtggagaccaaagaccagaaggtgctgatggtgcgtgaagccgagctgcagcccatgaacccgcctcgcttcgacttactggaggacatggccatgatgacgcacctgaacgaggcctctgtgctgcacaacctgcgccagcgctatgcccgctggatgatctatacctactcaggcctcttctgtgtcaccatcaacccctacaaatggctcccagtctatacggcctccgtagtggctgcttacaagggaaagcgccgctcagattccccgccccatatatatgcggtggcggacaacgcctacaacgacatgctgcgcaaccgagacaaccagtccatgctgatcacgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - preferentially expressed antigen in melanoma - similar to hypothetical protein MGC27019 - golgi reassembly stacking protein 1, 65kDa - dynactin 1 (p150, glued homolog, Drosophila) |