Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ADAMTS12-ADAM metallopeptidase with thrombospondin type 1 motif, 12 Gene
PTXBC058841
New product
Data sheet of ADAMTS12-ADAM metallopeptidase with thrombospondin type 1 motif, 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ADAMTS12-ADAM metallopeptidase with thrombospondin type 1 motif, 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058841 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ADAMTS12 |
| Origin species: | Human |
| Product name: | ADAMTS12-ADAM metallopeptidase with thrombospondin type 1 motif, 12 Gene |
| Size: | 2ug |
| Accessions: | BC058841 |
| Gene id: | 81792 |
| Gene description: | ADAM metallopeptidase with thrombospondin type 1 motif, 12 |
| Synonyms: | PRO4389; A disintegrin and metalloproteinase with thrombospondin motifs 12; ADAM-TS 12; ADAM-TS12; ADAMTS-12; a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12; ADAM metallopeptidase with thrombospondin type 1 motif 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccatgtgcccagaggagctggcttgcaaacctttccgtggtggctcagctccttaactttggggcgctttgctatgggagacagcctcagccaggcccggttcgcttcccggacaggaggcaagagcattttatcaagggcctgccagaataccacgtggtgggtccagtccgagtagatgccagtgggcattttttgtcatatggcttgcactatcccatcacgagcagcaggaggaagagagatttggatggctcagaggactgggtgtactacagaatttctcacgaggagaaggacctgttttttaacttgacggtcaatcaaggatttctttccaatagctacatcatggagaagagatatgggaacctctcccatgttaagatgatggcttcctcagcccccctctgccatctcagtggcacggttctacagcagggcaccagagttgggacggcagccctcagtgcctgccatggactgactggatttttccaactaccacatggagactttttcattgaacccgtgaagaagcatccactggttgagggagggtaccacccgcacatcgtttacaggaggcagaaagttccagaaaccaaggagccaacctgtggattaaagggtattgtgactcacatgtcctcctgggttgaagaatctgttttgttcttttggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein kinase, AMP-activated, gamma 2 non-catalytic subunit - tRNA-yW synthesizing protein 1 homolog B (non-protein coding) - mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) - nudix (nucleoside diphosphate linked moiety X)-type motif 14 |