Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of AMBP-alpha-1-microglobulin/bikunin precursor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AMBP-alpha-1-microglobulin/bikunin precursor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC041593 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AMBP |
| Origin species: | Human |
| Product name: | AMBP-alpha-1-microglobulin/bikunin precursor Gene |
| Size: | 2ug |
| Accessions: | BC041593 |
| Gene id: | 259 |
| Gene description: | alpha-1-microglobulin/bikunin precursor |
| Synonyms: | protein AMBP; A1M; EDC1; HCP; HI30; IATIL; ITI; ITIL; ITILC; UTI; bikunin; complex-forming glycoprotein heterogeneous in charge; growth-inhibiting protein 19; inter-alpha-trypsin inhibitor light chain; protein HC; trypstatin; uristatin; uronic-acid-rich protein; alpha-1-microglobulin/bikunin precursor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggagcctcggggccctgctcttgctgctgagcgcctgcctggcggtgagcgctggccctgtgccaacgccgcccgacaacatccaagtgcaggaaaacttcaatatctctcggatctatgggaagtggtacaacctggccatcggttccacctgcccctggctgaagaagatcatggacaggatgacagtgagcacgctggtgctgggagagggcgctacagaggcggagatcagcatgaccagcactcgttggcggaaaggtgtctgtgaggagacgtctggagcttatgagaaaacagatactgatgggaagtttctctatcacaaatccaaatggaacataaccatggagtcctatgtggtccacaccaactatgatgagtatgccattttcctgaccaagaaattcagccgccatcatggacccaccattactgccaagctctacgggcgggcgccgcagctgagggaaactctcctgcaggacttcagagtggttgcccagggtgtgggcatccctgaggactccatcttcaccatggctgaccgaggtgaatgtgtccctggggagcaggaaccagagcccatcttaatcccgagagtccggagggctgtgctaccccaagaagaggaaggatcagggggtgggcaactggtaactgaagtcaccaagaaagaagattcctgccagctgggctactcggccggtccctgcatgggaatgaccagcaggtatttctataatggtacatccatggcctgtgagactttccagtacggcggctgcatgggcaacggtaacaacttcgtcacagaaaaggagtgtctgcagacctgccgaactgtggcggcctgcaatctccccatagtccggggcccctgccgagccttcatccagctctgggcatttgatgctgtcaaggggaagtgcgtcctcttcccctacgggggctgccagggcaacgggaacaagttctactcagagaaggagtgcagagagtactgcggtgtccctggtgatggtgatgaggagctgctgcgcttctccaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 19 open reading frame 46 - solute carrier family 25, member 27 - immunoglobulin lambda variable 2-14 - seryl-tRNA synthetase 2, mitochondrial |