Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PTPN18-protein tyrosine phosphatase, non-receptor type 18 (brain-derived) Gene
PTXBC052800
New product
Data sheet of PTPN18-protein tyrosine phosphatase, non-receptor type 18 (brain-derived) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTPN18-protein tyrosine phosphatase, non-receptor type 18 (brain-derived) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC052800 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTPN18 |
| Origin species: | Human |
| Product name: | PTPN18-protein tyrosine phosphatase, non-receptor type 18 (brain-derived) Gene |
| Size: | 2ug |
| Accessions: | BC052800 |
| Gene id: | 26469 |
| Gene description: | protein tyrosine phosphatase, non-receptor type 18 (brain-derived) |
| Synonyms: | BDP1; PTP-HSCF; tyrosine-protein phosphatase non-receptor type 18; brain-derived phosphatase; protein tyrosine phosphatase, non-receptor type 18 (brain-derived); protein tyrosine phosphatase, non-receptor type 18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccgcagcctggactcggcgcggagcttcctggagcggctggaagcgcggggcggccgggagggggcagtcctcgccggcgagttcagcaaaaggtgtgagcggtactgggcccaggagcaggagccactgcagactgggcttttctgcatcactctgataaaggagaagtggctgaatgaggacatcatgctcaggaccctcaaggtcacattccagaaggagtcccgttctgtgtaccagctacagtatatgtcctggccagaccgtggggtccccagcagtcctgaccacatgctcgccatggtggaggaagcccgtcgcctccagggatctggccctgaacccctctgtgtccactgcagtgcgggttgtgggcgaacaggcgtcctgtgcaccgtggattatgtgaggcagctgctcctgacccagatgatcccacctgacttcagtctctttgatgtggtccttaagatgaggaagcagcggcctgcggccgtgcagacagaggagcagtacaggttcctgtaccacacggtggctcagatgttctgctccacactccagaatgccagcccccactaccagaacatcaaagagaattgtgccccactctacgacgatgccctcttcctccggactccccaggcacttctcgccataccccgcccaccaggaggggtcctcaggagcatctctgtgcccgggtccccgggccacgccatggctgacacctacgcggtggtgcagaagcgcggggctccagcgggcgccgggagtgggacgcagacggggacggggacgggggcgcgcagcgcggaggaggcgccgctctacagcaaggtgacgccgcgcgcccagcgacccggggcgcacgcggaggacgcgagggggacgctgcctggccgcgttcctgctgaccaaagtcctgccggatctggcgcctacgaggacgtggcgggtggagctcagaccggtgggctaggtttcaacctgcgcattgggaggccgaagggtccccgggacccgcctgctgagtggacccgggtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium voltage-gated channel, shaker-related subfamily, member 6 - UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 - asp (abnormal spindle) homolog, microcephaly associated (Drosophila) - solute carrier family 1 (neutral amino acid transporter), member 5 |