Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CASP1-caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) Gene
PTXBC062327
New product
Data sheet of CASP1-caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CASP1-caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062327 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CASP1 |
| Origin species: | Human |
| Product name: | CASP1-caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) Gene |
| Size: | 2ug |
| Accessions: | BC062327 |
| Gene id: | 834 |
| Gene description: | caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) |
| Synonyms: | CASP1 nirs variant 1; ICE; IL1BC; P45; IL-1 beta-converting enzyme; IL1B-convertase; caspase 1, apoptosis-related cysteine peptidase; interleukin 1, beta, convertase; interleukin 1-B converting enzyme; caspase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgacaaggtcctgaaggagaagagaaagctgtttatccgttccatgggtgaagctcctcaggcagtgcaggacaacccagctatgcccacatcctcaggctcagaagggaatgtcaagctttgctccctagaagaagctcaaaggatatggaaacaaaagtcggcagagatttatccaataatggacaagtcaagccgcacacgtcttgctctcattatctgcaatgaagaatttgacagtattcctagaagaactggagctgaggttgacatcacaggcatgacaatgctgctacaaaatctggggtacagcgtagatgtgaaaaaaaatctcactgcttcggacatgactacagagctggaggcatttgcacaccgcccagagcacaagacctctgacagcacgttcctggtgttcatgtctcatggtattcgggaaggcatttgtgggaagaaacactctgagcaagtcccagatatactacaactcaatgcaatctttaacatgttgaataccaagaactgcccaagtttgaaggacaaaccgaaggtgatcatcatccaggcctgccgtggtgacagccctggtgtggtgtggtttaaagattcagtaggagtttctggaaacctatctttaccaactacagaagagtttgaggatgatgctattaagaaagcccacatagagaaggattttatcgctttctgctcttccacaccagataatgtttcttggagacatcccacaatgggctctgtttttattggaagactcattgaacatatgcaagaatatgcctgttcctgtgatgtggaggaaattttccgcaaggttcgattttcatttgagcagccagatggtagagcgcagatgcccaccactgaaagagtgactttgacaagatgtttctacctcttcccaggacattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 - killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1 - solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 - 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase |