Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KIR2DL1-killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1 Gene
PTXBC069344
New product
Data sheet of KIR2DL1-killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIR2DL1-killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069344 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIR2DL1 |
| Origin species: | Human |
| Product name: | KIR2DL1-killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1 Gene |
| Size: | 2ug |
| Accessions: | BC069344 |
| Gene id: | 3802 |
| Gene description: | killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1 |
| Synonyms: | CD158A; KIR-K64; KIR221; NKAT; NKAT-1; NKAT1; p58.1; killer cell immunoglobulin-like receptor 2DL1; CD158 antigen-like family member A; MHC class I NK cell receptor; killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1; killer inhibitory receptor 2-2-1; natural killer-associated transcript 1; p58 NK cell inhibitory receptor NKR-K6; p58 NK receptor CL-42/47.11; p58 killer cell inhibitory receptor KIR-K64; p58 natural killer cell receptor clones CL-42/47.11; p58.1 MHC class-I-specific NK receptor; killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgctcttggtcgtcagcatggcgtgtgttgggttcttcttgctgcagggggcctggccacatgagggagtccacagaaaaccttccctcctggcccacccaggtcgcctggtgaaatcagaagagacagtcatcctgcagtgttggtcagatgtcatgtttgaacacttccttctgcacagagaggggatgtttaacgacactttgcgcctcattggagaacaccatgatggggtctccaaggccaacttctccatcagtcgcatgacgcaagacctggcagggacctacagatgctacggttctgttactcactccccctatcaggtgtcagctcccagtgaccctctggacatcgtgatcataggtctatatgagaaaccttctctctcagcccagctgggccccacggttctggcaggagagaatgtgaccttgtcctgcagctcccggagctcctatgacatgtaccatctatccagggaaggggaggcccatgaacgtaggctccctgcagggcccaaggtcaacggaacattccaggctgactttcctctgggccctgccacccacggagggacctacagatgcttcggctctttccatgactctccatacgagtggtcaaagtcaagtgacccactgcttgtttctgtcacaggaaacccttcaaatagttggccttcacccactgaaccaagctccaaaaccgagaggatgtttcaccacgttggccaagcttgtctgaaactcccaacctcaagtgatccgaccgtctcagcatgccaaagtaacccccgacacctgcacattctgattgggacctcagtggtcatcatcctcttcatcctcctcttctttctccttcatcgctggtgctccaacaaaaaaaatgctgcggtaatggaccaagagtctgcaggaaacagaacagcgaatagcgaggactctgatgaacaagaccctcaggaggtgacatacacacagttgaatcactgcgttttcacacagagaaaaatcactcgcccttctcagaggcccaagacacccccaacagatatcatcgtgtacacggaacttccaaatgctgagtccagatccaaagttgtctcctgcccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 - 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase - aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase) - solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 |