Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of VHL-von Hippel-Lindau tumor suppressor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VHL-von Hippel-Lindau tumor suppressor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058831 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VHL |
| Origin species: | Human |
| Product name: | VHL-von Hippel-Lindau tumor suppressor Gene |
| Size: | 2ug |
| Accessions: | BC058831 |
| Gene id: | 7428 |
| Gene description: | von Hippel-Lindau tumor suppressor |
| Synonyms: | HRCA1; RCA1; VHL1; pVHL; von Hippel-Lindau disease tumor suppressor; elongin binding protein; protein G7; von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase; von Hippel-Lindau tumor suppressor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccccggagggcggagaactgggacgaggccgaggtaggcgcggaggaggcaggcgtcgaagagtacggccctgaagaagacggcggggaggagtcgggcgccgaggagtccggcccggaagagtccggcccggaggaactgggcgccgaggaggagatggaggccgggcggccgcggcccgtgctgcgctcggtgaactcgcgcgagccctcccaggtcatcttctgcaatcgcagtccgcgcgtcgtgctgcccgtatggctcaacttcgacggcgagccgcagccctacccaacgctgccgcctggcacgggccgccgcatctacagctaccgagtgtatactctgaaagagcgatgcctccaggttgtccggagcctagtcaagcctgagaattacaggagactggacatcgtcaggtcgctctacgaagatctggaagaccacccaaatgtgcagaaagacctggagcggctgacacaggagcgcattgcacatcaacggatgggagattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - thioredoxin domain containing 5 - transducin (beta)-like 1X-linked - peroxisomal biogenesis factor 13 - WAP four-disulfide core domain 9 |