PEX13-peroxisomal biogenesis factor 13 Gene View larger

PEX13-peroxisomal biogenesis factor 13 Gene

PTXBC067090

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PEX13-peroxisomal biogenesis factor 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PEX13-peroxisomal biogenesis factor 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC067090
Product type: DNA & cDNA
Ncbi symbol: PEX13
Origin species: Human
Product name: PEX13-peroxisomal biogenesis factor 13 Gene
Size: 2ug
Accessions: BC067090
Gene id: 5194
Gene description: peroxisomal biogenesis factor 13
Synonyms: peroxisomal membrane protein PEX13; NALD; PBD11A; PBD11B; ZWS; peroxisome biogenesis factor 13; peroxin-13; peroxisomal biogenesis factor 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtcccagccgccacctccccccaaaccctgggagacccgccgaattccgggagccggaccgggaccaggaccgggccccactttccaatctgctgatttgggtcctactttaatgacaagacctggacaaccagcacttaccagagtgcccccacctattcttccaaggccatcacagcagacaggaagtagcagtgtgaacacttttagacctgcttacagttcattttcttctggatatggtgcctatggaaattcattttatggaggctatagtccttatagttatggatataatgggctgggctacaaccgcctccgtgtagatgatcttccacccagtagatttgttcagcaagctgaagaaagcagcaggggtgcatttcagtccattgaaagtattgtgcatgcatttgcctctgtcagtatgatgatggatgctaccttttcagctgtctataacagtttcagggctgtattggatgtagcaaatcacttttcccgattgaaaatacactttacaaaagtgttttcagcttttgcattggttaggactatacggtatctttacagacggctacagcggatgttaggtttaagaagaggctctgagaatgaagacctctgggcagagagtgaaggaactgtggcatgccttggtgctgaggaccgagcagctacctcagcaaaatcttggccaatattcttgttctttgctgttatccttggtggtccttacctcatttggaaactattgtctactcacagtgatgaagtaacagacagcatcaactgggcaagtggtgaggatgaccatgtagttgccagagcagaatatgattttgctgccgtatctgaagaagaaatttctttccgggctggtgatatgctgaacttagctctcaaagaacaacaacccaaagtgcgtggttggcttctggctagccttgatggccaaacaacaggacttatacctgcgaattatgtcaaaattcttggcaaaagaaaaggtaggaaaacggtggaatcaagtaaagtttccaagcagcaacaatcttttaccaacccaacactaactaaaggagccacggttgctgattctttggatgaacaggaagctgcctttgaatctgtttttgttgaaactaataaggttccagttgcacctgattccattgggaaagatggagaaaagcaagatctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WAP four-disulfide core domain 9
- serine active site containing 1
- hypothetical protein FLJ10490
- thyroid stimulating hormone, beta

Buy PEX13-peroxisomal biogenesis factor 13 Gene now

Add to cart