Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM89B-family with sequence similarity 89, member B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM89B-family with sequence similarity 89, member B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC023991 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM89B |
| Origin species: | Human |
| Product name: | FAM89B-family with sequence similarity 89, member B Gene |
| Size: | 2ug |
| Accessions: | BC023991 |
| Gene id: | 23625 |
| Gene description: | family with sequence similarity 89, member B |
| Synonyms: | protein FAM89B; LRAP25; MTVR; MTVR1; leucine repeat adaptor protein 25; mammary tumor virus receptor homolog 1; family with sequence similarity 89 member B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacgggctgccctcggcagaggcgccgggcggggcgggctgcgctttggccgggctcccaccgctgccgcgcggcctcagcggcctccttaatgcgagcgggggctcgtggcgggagctggagcgcgtctacagccagcgcagccgcgtcgtcctgtcaacctcgactcagcgctggccgcgctgcgcaaggagatgttgtctgcaggtggggctgcggcagttggacatgtccttgttgtgccagctgtggggcctgtacgagtcaatccaggactacaaacacctgtgccaagacctgagcttctgccaggacctgtcatcctccctccattcggacagctcctacccaccggatgcgggcctgtctgacgacgaggagcctcccgatgccagcctgcctcctgacccgccaccccttactgtgccccagacgcacaatgcccgtgaccagtggctgcaggatgccttccacatcagcctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 58, member A - family with sequence similarity 44, member B - phosphatidylinositol transfer protein, alpha - dehydrogenase/reductase (SDR family) member 2 |