Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DHRS2-dehydrogenase/reductase (SDR family) member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DHRS2-dehydrogenase/reductase (SDR family) member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002786 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DHRS2 |
| Origin species: | Human |
| Product name: | DHRS2-dehydrogenase/reductase (SDR family) member 2 Gene |
| Size: | 2ug |
| Accessions: | BC002786 |
| Gene id: | 10202 |
| Gene description: | dehydrogenase/reductase (SDR family) member 2 |
| Synonyms: | HEP27; SDR25C1; dehydrogenase/reductase SDR family member 2, mitochondrial; dehydrogenase/reductase (SDR family) member 2; dehydrogenase/reductase member 2; dicarbonyl reductase HEP27; protein D; short chain dehydrogenase/reductase family 25C member 1; short-chain alcohol dehydrogenase family member; dehydrogenase/reductase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgtcagcagttgcccggggctaccagggctggtttcatccctgtgctaggctttctgtgaggatgagcagcaccgggatagacaggaagggcgtcctggctaaccgggtagccgtggtcacggggtccaccagtgggatcggctttgccatcgcccgacgtctggcccgggacggggcccacgtggtcatcagcagccggaagcagcagaacgtggaccgggccatggccaagctgcagggggaggggctgagtgtggcgggcattgtgtgccacgtggggaaggctgaggaccgggagcagctggtggccaaggccctggagcactgtgggggcgtcgacttcctggtgtgcagcgcaggggtcaaccctctggtagggagcactctggggaccagtgagcagatctgggacaagatcctaagtgtgaacgtgaagtccccagccctgctgctgagccagttgctgccctacatggagaacaggaggggtgctgtcatcctggtctcttccattgcagcttataatccagtagtggcgctgggtgtctacaatgtcagcaagacagcgctgctgggtctcactagaacactggcattggagctggcccccaaggacatccgggtaaactgcgtggttccaggaattatcaaaactgacttcagcaaagtggtgaggattggtttcatgggaatgagtctctctggaagaacttcaaggaacatcatcagctgcagaggattggggagtcagaggactgtgcaggaatcgtgtccttcctgtgctctccagatgccagctacgtcaacggggagaacattgcggtggcaggctactccactcggctctgagaggagtgggggcggctgcgtagctgtggtcccaggcccaggagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 83, member A - proprotein convertase subtilisin/kexin type 7 - adenomatosis polyposis coli down-regulated 1 - family with sequence similarity 63, member B |