Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CXCL9-chemokine (C-X-C motif) ligand 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CXCL9-chemokine (C-X-C motif) ligand 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063122 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CXCL9 |
| Origin species: | Human |
| Product name: | CXCL9-chemokine (C-X-C motif) ligand 9 Gene |
| Size: | 2ug |
| Accessions: | BC063122 |
| Gene id: | 4283 |
| Gene description: | chemokine (C-X-C motif) ligand 9 |
| Synonyms: | CMK; Humig; MIG; SCYB9; crg-10; C-X-C motif chemokine 9; chemokine (C-X-C motif) ligand 9; gamma-interferon-induced monokine; monokine induced by gamma interferon; monokine induced by interferon-gamma; small-inducible cytokine B9; C-X-C motif chemokine ligand 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagaaaagtggtgttcttttcctcttgggcatcatcttgctggttctgattggagtgcaaggaaccccagtagtgagaaagggtcgctgttcctgcatcagcaccaaccaagggactatccacctacaatccttgaaagaccttaaacaatttgccccaagcccttcctgcgagaaaattgaaatcattgctacactgaagaatggagttcaaacatgtctaaacccagattcagcagatgtgaaggaactgattaaaaagtgggagaaacaggtcagccaaaagaaaaagcaaaagaatgggaaaaaacatcaaaaaaagaaagttctgaaagttcgaaaatctcaacgttctcgtcaaaagaagactacataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein FLJ40125 - von Hippel-Lindau tumor suppressor - thioredoxin domain containing 5 - transducin (beta)-like 1X-linked |