No products
Prices are tax excluded
PTXBC002613
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002613 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C9orf142 |
| Origin species: | Human |
| Product name: | C9orf142-chromosome 9 open reading frame 142 Gene |
| Size: | 2ug |
| Accessions: | BC002613 |
| Gene id: | 286257 |
| Gene description: | chromosome 9 open reading frame 142 |
| Synonyms: | PAXX; XLS; protein PAXX; XRCC4-like small protein; paralog of XRCC4 and XLF; chromosome 9 open reading frame 142 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatccgctgtcgccgccgctctgcacgctgccgccgggccccgagccgccccgcttcgtgtgctactgcgaaggggaggaaagcggggagggggaccgcggcggcttcaacctctacgtgaccgacgccgcggagctttggagcacctgcttcacgccggacagcctggcggccctcaaagcccgttttggcctgagtgcggctgaggacatcaccccccggttcagggcagcctgtgagcagcaagctgtggctctgactctgcaggaggacagagcatccctgacgctttcaggggggccctcggcactggcctttgacctctccaaggtaccaggcccagaggcagcccccaggctgcgggcgctgacactgggcctggcaaaacgcgtgtggagcctggagcggcgactggcagctgcagaagagacagctgtcagcccgaggaagagcccccggcctgcagggcctcagctcttcttaccagacccagatccccagagaggtggccctggacctggagtcaggaggcggtgtccaggagagtcgctcatcaaccccgggttcaagagtaagaaaccagctggtggcgtggacttcgatgagacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 16 open reading frame 45 - chromosome 1 open reading frame 210 - chromosome 15 open reading frame 57 - heparin-binding EGF-like growth factor |