Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HBEGF-heparin-binding EGF-like growth factor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HBEGF-heparin-binding EGF-like growth factor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033097 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HBEGF |
| Origin species: | Human |
| Product name: | HBEGF-heparin-binding EGF-like growth factor Gene |
| Size: | 2ug |
| Accessions: | BC033097 |
| Gene id: | 1839 |
| Gene description: | heparin-binding EGF-like growth factor |
| Synonyms: | DTR; DTS; DTSF; HEGFL; proheparin-binding EGF-like growth factor; diphtheria toxin receptor (heparin-binding EGF-like growth factor); diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor); heparin-binding epidermal growth factor; heparin binding EGF like growth factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagctgctgccgtcggtggtgctgaagctctttctggctgcagttctctcggcactggtgactggcgagagcctggagcggcttcggagagggctagctgctggaaccagcaacccggaccctcccactgtatccacggaccagctgctacccctaggaggcggccgggaccggaaagtccgtgacttgcaagaggcagatctggaccttttgagagtcactttatcctccaagccacaagcactggccacaccaaacaaggaggagcacgggaaaagaaagaagaaaggcaaggggctagggaagaagagggacccatgtcttcggaaatacaaggacttctgcatccatggagaatgcaaatatgtgaaggagctccgggctccctcctgcatctgccacccgggttaccatggagagaggtgtcatgggctgagcctcccagtggaaaatcgcttatatacctatgaccacacaaccatcctggccgtggtggctgtggtgctgtcatctgtctgtctgctggtcatcgtggggcttctcatgtttaggtaccataggagaggaggttatgatgtggaaaatgaagagaaagtgaagttgggcatgactaattcccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 10 open reading frame 47 - chromosome 19 open reading frame 40 - chromosome 21 open reading frame 45 - oligodendrocyte transcription factor 3 |