Cart 20 Product Products 3 817,09 € (empty)
-
1 x DEFB1-defe...113,40 € -
-
1 x Goat...199,00 € -
1 x PPAP2B-pho...121,50 € -
1 x HSDL1-hydr...121,50 € -
1 x ACTR2-ARP2...121,50 € -
1 x PRPF40A-PR...113,40 € -
1 x GMPR2-guan...121,50 € -
1 x Chicken...311,00 € -
1 x DNAJA4-Dna...121,50 € -
1 x CKS2-CDC28...113,40 € -
1 x Goat...1 189,00 € -
1 x Goat...201,00 € -
-
1 x DLK1-delta...121,50 € -
1 x DVL1-dishe...121,50 € -
1 x AVL9-AVL9...121,50 € -
1 x POLB-polym...121,50 € -
-
1 x BUB3-buddi...121,50 €
No products
To be determined Shipping
3 817,09 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 20 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 817,09 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 817,09 €
Data sheet of UBE3C-ubiquitin protein ligase E3C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE3C-ubiquitin protein ligase E3C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026241 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE3C |
| Origin species: | Human |
| Product name: | UBE3C-ubiquitin protein ligase E3C Gene |
| Size: | 2ug |
| Accessions: | BC026241 |
| Gene id: | 9690 |
| Gene description: | ubiquitin protein ligase E3C |
| Synonyms: | HECTH2; ubiquitin-protein ligase E3C; HECT-type ubiquitin transferase E3C; ubiquitin-protein isopeptide ligase (E3); ubiquitin protein ligase E3C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcagcttcgaaggcgacttcaagacgcggcccaaggtgtcccttggcggcgcgagcaggaagtattccatccaaagaagtgcatttgatcgctgtgctaccttgtcacagtccgggggcgcttttcccattgctaatggccccaaccttacccttttggtaaggcagcttctgtttttttacaaacaaaatgaagactcaaaacgtttgatatggctgtatcagaacttaattaaacacagctctctgtttgtcaagcagttggatggatctgagagacttacatgcttatttcagataaaaagattgatgagcctctgttgcaggttgctgcaaaactgtaatgatgacagtttgaatgttgcacttccaatgagaatgcttgaagtattttcgtctgagaatacttacttgcctgttttacaagatgctagctatgtggtgtcagtgattgaacaaattttgcactacatgattcacaatgggtattataggtctctatatttgttgattaacagcaagcttccatcaagtattgaatattctgatttatctcgagttcctatagcaaaaattttgctagagaatgttctaaaaccattgcactttacttacaactcctgtccggaaggtgcgaggcaacaagtttttacagccttcacagaggagtttctggcagcaccttttacagatcagatttttcatttcatcattccggcgcttgcagatgcgcagaccgttttcccttacgagccctttctgaatgcactgttgttaatagagagtagatgttcaagaaagagtggtggagcaccctggcttttctatttcgttttaactgttggcgaaaattatttgggggccctctctgaggaagggctgctggtgtatttgcgggtgctgcagaccttcctctctcagttaccagtctctcctgccagcgcgagctgtcacgactcagccagtgactctgaggaggagagtgaagaagccgacaagccctcaagcccggaggatggcagactgtcagtatcatacataacagaggaatgcctgaagaagctggacacaaagcagcagaccaacaccctgctcaacctggtgtggagggactctgcgagcgaggaggtcttcaccaccatggcctccgtctgccacacgctgatggtgcagcaccgcatgatggtacccaaagtcagggtgtacaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding motif protein 34 - variable charge, Y-linked 1B - mitochondrial protein 18 kDa - immunoglobulin kappa constant |