Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MTP18-mitochondrial protein 18 kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MTP18-mitochondrial protein 18 kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001608 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MTP18 |
| Origin species: | Human |
| Product name: | MTP18-mitochondrial protein 18 kDa Gene |
| Size: | 2ug |
| Accessions: | BC001608 |
| Gene id: | 51537 |
| Gene description: | mitochondrial protein 18 kDa |
| Synonyms: | mitochondrial fission protein MTP18; MTP18; HSPC242; mitochondrial fission process protein 1; mitochondrial 18 kDa protein; mitochondrial protein 18 kDa; mitochondrial fission process 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcagagccgcagccgcggggcgcagagcgcgatctctaccgggacacgtgggtgcgatacctgggctatgccaatgaggtgggcgaggctttccgctctcttgtgccagcggcggtggtgtggctgagctatggcgtggccagctcctacgtgctggcggatgccattgacaaaggcaagaaggctggagaggtgcccagccctgaagcaggccgcagcgccagggtgaccgtggctgtggtggacacctttgtatggcaggctctagcctctgtggccattccgggcttcaccatcaaccgcgtgtgtgctgcctctctctatgtcctgggcactgccacccgctggcccctggctgtccgcaagtggaccaccaccgcgcttgggctgttgaccatccccatcattatccaccccattgacaggtcggtggatttcctcctggactccagcctgcgcaagctctacccaacagtggggaagcccagctcctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - immunoglobulin kappa constant - integrator complex subunit 4 - C-terminal binding protein 1 - SAPS domain family, member 2 |