Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DARC-Duffy blood group, chemokine receptor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DARC-Duffy blood group, chemokine receptor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017817 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DARC |
| Origin species: | Human |
| Product name: | DARC-Duffy blood group, chemokine receptor Gene |
| Size: | 2ug |
| Accessions: | BC017817 |
| Gene id: | 2532 |
| Gene description: | Duffy blood group, chemokine receptor |
| Synonyms: | DARC; CCBP1; CD234; Dfy; GPD; GpFy; WBCQ1; atypical chemokine receptor 1; Duffy antigen chemokine receptor; Duffy blood group antigen; Duffy blood group system protein; Duffy blood group, chemokine receptor; Fy glycoprotein; glycoprotein D; plasmodium vivax receptor; atypical chemokine receptor 1 (Duffy blood group) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaactgtctgcacagggcggagctctccccctcaactgagaactcaagtcagctggacttcgaagatgtatggaattcttcctatggtgtgaatgattccttcccagatggagactatggtgccaacctggaagcagctgccccctgccactcctgtaacctgctggatgactctgcactgcccttcttcatcctcaccagtgtcctgggtatcctagctagcagcactgtcctcttcatgcttttcagacctctcttccgctggcagctctgccctggctggcctgtcctggcacagctggctgtgggcagtgccctcttcagcattgtggtgcccgtcttggccccagggctaggtagcactcgcagctctgccctgtgtagcctgggctactgtgtctggtatggctcagcctttgcccaggctttgctgctagggtgccatgcctccctgggccacagactgggtgcaggccaggtcccaggcctcaccctggggctcactgtgggaatttggggagtggctgccctactgacactgcctgtcaccctggccagtggtgcttctggtggactctgcaccctgatatacagcacggagctgaaggctttgcaggccacacacactgtagcctgtcttgccatctttgtcttgttgccattgggtttgtttggagccaaggggctgaagaaggcattgggtatggggccaggcccctggatgaacatcctgtgggcctggtttattttctggtggcctcatggggtggttctaggactggatttcctggtgaggtccaagctgttgctgttgtcaacatgtctggcccagcaggctctggacctgctgctgaacctggcagaagccctggcaattttgcactgtgtggctacgcccctgctcctcgccctattctgccaccaggccacccgcaccctcttgccctctctgcccctccctgaaggatggttttctcatctggacacccttggaagcaaatcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome X open reading frame 21 - chromosome 2 open reading frame 47 - R-spondin 3 homolog (Xenopus laevis) - chromosome 9 open reading frame 41 |