No products
Prices are tax excluded
PTXBC022367
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC022367 |
Product type: | DNA & cDNA |
Ncbi symbol: | RSPO3 |
Origin species: | Human |
Product name: | RSPO3-R-spondin 3 homolog (Xenopus laevis) Gene |
Size: | 2ug |
Accessions: | BC022367 |
Gene id: | 84870 |
Gene description: | R-spondin 3 homolog (Xenopus laevis) |
Synonyms: | CRISTIN1; PWTSR; THSD2; R-spondin-3; R-spondin 3 homolog; protein with TSP type-1 repeat; roof plate-specific spondin-3; thrombospondin type-1 domain-containing protein 2; thrombospondin, type I, domain containing 2; R-spondin 3 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcacttgcgactgatttcttggctttttatcattttgaactttatggaatacatcggcagccaaaacgcctcccggggaaggcgccagcgaagaatgcatcctaacgttagtcaaggctgccaaggaggctgtgcaacatgctcagattacaatggatgtttgtcatgtaagcccagactattttttgctctggaaagaattggcatgaagcagattggagtatgtctctcttcatgtccaagtggatattatggaactcgatatccagatataaataagtgtacaaaatgcaaagctgactgtgatacctgtttcaacaaaaatttctgcacaaaatgtaaaagtggattttacttacaccttggaaagtgccttgacaattgcccagaagggttggaagccaacaaccatactatggagtgtgtcagtattgtgcactgtgaggtcagtgaatggaatccttggagtccatgcacgaagaagggaaaaacatgtggcttcaaaagagggactgaaacacgggtccgagaaataatacagcatccttcagcaaagggtaacctgtgtcccccaacaaatgagacaagaaagtgtacagtgcaaaggaagaagtgtcagaagggagaacgaggaaaaaaaggaagggagaggaaaagaaaaaaacctaataaaggagaaagtaaagaagcaatacctgacagcaaaagtctggaatccagcaaagaaatcccagagcaacgagaaaacaaacagcagcagaagaagcgaaaagtccaagataaacagaaatcggtatcagtcagcactgtacactag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - chromosome 9 open reading frame 41 - basic leucine zipper and W2 domains 1 - mitochondrial ribosomal protein S24 - mitochondrial ribosomal protein L21 |