No products
Prices are tax excluded
PTXBC022367
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022367 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RSPO3 |
| Origin species: | Human |
| Product name: | RSPO3-R-spondin 3 homolog (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC022367 |
| Gene id: | 84870 |
| Gene description: | R-spondin 3 homolog (Xenopus laevis) |
| Synonyms: | CRISTIN1; PWTSR; THSD2; R-spondin-3; R-spondin 3 homolog; protein with TSP type-1 repeat; roof plate-specific spondin-3; thrombospondin type-1 domain-containing protein 2; thrombospondin, type I, domain containing 2; R-spondin 3 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcacttgcgactgatttcttggctttttatcattttgaactttatggaatacatcggcagccaaaacgcctcccggggaaggcgccagcgaagaatgcatcctaacgttagtcaaggctgccaaggaggctgtgcaacatgctcagattacaatggatgtttgtcatgtaagcccagactattttttgctctggaaagaattggcatgaagcagattggagtatgtctctcttcatgtccaagtggatattatggaactcgatatccagatataaataagtgtacaaaatgcaaagctgactgtgatacctgtttcaacaaaaatttctgcacaaaatgtaaaagtggattttacttacaccttggaaagtgccttgacaattgcccagaagggttggaagccaacaaccatactatggagtgtgtcagtattgtgcactgtgaggtcagtgaatggaatccttggagtccatgcacgaagaagggaaaaacatgtggcttcaaaagagggactgaaacacgggtccgagaaataatacagcatccttcagcaaagggtaacctgtgtcccccaacaaatgagacaagaaagtgtacagtgcaaaggaagaagtgtcagaagggagaacgaggaaaaaaaggaagggagaggaaaagaaaaaaacctaataaaggagaaagtaaagaagcaatacctgacagcaaaagtctggaatccagcaaagaaatcccagagcaacgagaaaacaaacagcagcagaagaagcgaaaagtccaagataaacagaaatcggtatcagtcagcactgtacactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 9 open reading frame 41 - basic leucine zipper and W2 domains 1 - mitochondrial ribosomal protein S24 - mitochondrial ribosomal protein L21 |