Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of EMG1-EMG1 nucleolar protein homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EMG1-EMG1 nucleolar protein homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC055314 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EMG1 |
| Origin species: | Human |
| Product name: | EMG1-EMG1 nucleolar protein homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC055314 |
| Gene id: | 10436 |
| Gene description: | EMG1 nucleolar protein homolog (S. cerevisiae) |
| Synonyms: | EMG1, N1-specific pseudouridine methyltransferase; EMG1 nucleolar protein homolog; C2F; Grcc2f; NEP1; ribosomal RNA small subunit methyltransferase NEP1; 18S rRNA (pseudouridine(1248)-N1)-methyltransferase; 18S rRNA (pseudouridine-N1-)-methyltransferase NEP1; 18S rRNA Psi1248 methyltransferase; essential for mitotic growth 1; nucleolar essential protein 1; ribosome biogenesis protein NEP1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgcgcccagtgatggattcaagcctcgtgaacgaagcggtggggagcaggcacaggactgggatgctctgccacccaagcggccccgactaggggcaggaaacaagatcggaggccgtaggcttattgtggtgctggaaggggccagtctggagacagtcaaggtagggaagacatatgagctactcaactgtgacaagcacaagtctatattgttgaagaatggacgggaccctggggaagcgcggccagatatcacccaccagagtttgctgatgctgatggatagtcccctgaaccgagctggcttgctacaggtttatatccatacacagaagaatgttctgattgaagtgaatccccagacccgaattcccagaacctttgaccgcttttgtggcctcatggttcaacttttacacaagctcagtgttcgagcagctgatggcccccagaagcttttgaaggtaattaagaatccagtatcagatcactttccagttggatgtatgaaagttggcacttctttttccatcccggttgtcagtgatgtgcgtgagctggtgcccagcagtgatcctattgtttttgtggtaggggcctttgcccatggcaaggtcagtgtggagtatacagagaagatggtgtccatcagtaactaccccctttctgctgccctcacctgtgcaaaacttaccacagcctttgaggaagtatggggggtcatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - progestin and adipoQ receptor family member V - family with sequence similarity 45, member A - family with sequence similarity 89, member B - family with sequence similarity 58, member A |