Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V1B1-ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1 Gene
PTXBC035978
New product
Data sheet of ATP6V1B1-ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V1B1-ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035978 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V1B1 |
| Origin species: | Human |
| Product name: | ATP6V1B1-ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1 Gene |
| Size: | 2ug |
| Accessions: | BC035978 |
| Gene id: | 525 |
| Gene description: | ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1 |
| Synonyms: | ATP6B1; RTA1B; VATB; VMA2; VPP3; V-type proton ATPase subunit B, kidney isoform; ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1; H(+)-transporting two-sector ATPase, 58kD subunit; H+-ATPase beta 1 subunit; V-ATPase B1 subunit; V-ATPase subunit B 1; endomembrane proton pump 58 kDa subunit; vacuolar proton pump 3; vacuolar proton pump subunit B 1; vacuolar proton pump, subunit 3; ATPase H+ transporting V1 subunit B1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagatagacagcaggcccggggggctccccggcagtagctgcaacctaggtgcagcccgagaacacatgcaggcggtcacccgaaactacatcacccacccccgtgtcacctacaggactgtgtgcagcgtgaacgggcccctggtggtgctggaccgggtcaagtttgcccagtatgcggagatcgtccacttcaccctcccagatgggactcagaggagcgggcaggtgcttgaggtggctggcaccaaggcgattgttcaggtgtttgaagggacatcagggatcgatgccaggaagaccacttgcgaatttacaggggacatcctacgaactccggtgtcagaggacatgctgggtcgggttttcaatggctccggcaagcccattgacaaggggccagtggtcatggcggaggactttctggatatcaatggccagcccatcaacccgcactcccgcatctaccccgaggagatgattcagacgggcatttctcctattgacgtcatgaacagcattgcccgcggccagaagatccccatcttctcagcagccgggctcccccacaatgagattgccgctcagatctgccgccaggcggggctggtgaagaagtccaaggctgtgctggattaccatgacgacaacttcgccatcgtctttgcagccatgggggtgaacatggagacagccagattcttcaagtctgactttgagcagaatggaaccatggggaacgtctgcctcttcctgaacttggccaatgaccccacgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - killer cell immunoglobulin-like receptor, three domains, X1 - ADAM metallopeptidase with thrombospondin type 1 motif, 12 - protein kinase, AMP-activated, gamma 2 non-catalytic subunit - tRNA-yW synthesizing protein 1 homolog B (non-protein coding) |