Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MAPKSP1-MAPK scaffold protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAPKSP1-MAPK scaffold protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026245 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAPKSP1 |
| Origin species: | Human |
| Product name: | MAPKSP1-MAPK scaffold protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC026245 |
| Gene id: | 8649 |
| Gene description: | MAPK scaffold protein 1 |
| Synonyms: | MAPKSP1; MAP2K1IP1; MAPBP; MP1; PRO0633; Ragulator3; ragulator complex protein LAMTOR3; MAPK scaffold protein 1; MEK binding partner 1; late endosomal/lysosomal adaptor and MAPK and MTOR activator 3; mitogen-activated protein kinase kinase 1 interacting protein 1; mitogen-activated protein kinase scaffold protein 1; late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggatgacctaaagcgattcttgtataaaaagttaccaagtgttgaagggctccatgccattgttgtgtcagatagagatggagtacctgttattaaagtggcaaatgacaatgctccagagcatgctttacgacctggtttcttatccacttttgcccttgcaacagaccaaggaagcaaacttggactttccaaaaataaaagtatcatctgttactataacacctaccaggtggttcaatttaatcgtttacctttggtggtgagtttcatagccagcagcagtgccaatacaggactaattgtcagcctagaaaaggaacttgctccattgtttgaagaactgagacaagttgtggaagtttcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SH2 domain containing 1B - insulin-like 4 (placenta) - SPRY domain containing 4 - transmembrane protein 40 |