Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of INSL4-insulin-like 4 (placenta) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about INSL4-insulin-like 4 (placenta) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026254 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | INSL4 |
| Origin species: | Human |
| Product name: | INSL4-insulin-like 4 (placenta) Gene |
| Size: | 2ug |
| Accessions: | BC026254 |
| Gene id: | 3641 |
| Gene description: | insulin-like 4 (placenta) |
| Synonyms: | EPIL; PLACENTIN; early placenta insulin-like peptide; early placenta insulin-like peptide (EPIL); insulin-like 4 (placenta); insulin-like peptide 4; insulin like 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagcctgttccggtcctatctgccagcaatctggctgctgctgagccaactccttagagaaagcctagcagcagagctgaggggatgtggtccccgatttggaaaacacttgctgtcatattgccccatgcctgagaagacattcaccaccaccccaggagggtggctgctggaatctggacgtcccaaagaaatggtgtcaacctccaacaacaaagatggacaagccttaggtacgacatcagaattcattcctaatttgtcaccagagctgaagaaaccactgtctgaagggcagccatcattgaagaaaataatactttcccgcaaaaagagaagtggacgtcacagatttgatccattctgttgtgaagtaatttgtgacgatggaacttcagttaaattatgtacatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SPRY domain containing 4 - transmembrane protein 40 - immunoglobulin kappa locus - methyltransferase like 6 |