WSB1-WD repeat and SOCS box-containing 1 Gene View larger

WSB1-WD repeat and SOCS box-containing 1 Gene

PTXBC021110

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WSB1-WD repeat and SOCS box-containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WSB1-WD repeat and SOCS box-containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021110
Product type: DNA & cDNA
Ncbi symbol: WSB1
Origin species: Human
Product name: WSB1-WD repeat and SOCS box-containing 1 Gene
Size: 2ug
Accessions: BC021110
Gene id: 26118
Gene description: WD repeat and SOCS box-containing 1
Synonyms: SWIP1; WSB-1; WD repeat and SOCS box-containing protein 1; SOCS box-containing WD protein SWiP-1; WD repeat and SOCS box containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagctttcccccgagggtcaacgagaaagagatcgtgagattacgtactataggtgaacttttagctcctgcagctccttttgacaagaaatgtggtcgtgaaaattggactgttgcttttgctccagatggttcatactttgcttggtcacaaggacatcgcacagtaaagcttgttccgtggtcccagtgccttcagaactttctcttgcatggcaccaagaatgttaccaattcaagcagtttaagattgccaagacaaaatagtgatggtggtcagaaaaataagcctcgtgaacatattatagactgtggagatatagtctggagtcttgcttttgggtcatcagttccagaaaaacagagtcgctgtgtaaatatagaatggcatcgcttcagatttggacaagatcagctacttcttgctacagggttgaacaatgggcgtatcaaaatatgggatgtatatacaggaaaactcctccttaacttggtagatcatactgaagtggtcagagatttaacttttgctccagatggaagcttgatcctggtgtcagcttcaagagacaaaactctcagagtatgggacctgaaagatgatggaaacatgatgaaagtattgagggggcatcagaattgggtgtacagctgtgcattctctcctgactcttctatgctgtgttcagtcggagccagtaaagcagttttcctttggaatatggataaatacaccatgatacggaaactagaaggacatcaccatgatgtggtagcttgtgacttttctcctgatggagcattactggctactgcatcttatgatactcgagtatatatctgggatccacataatggagacattctgatggaatttgggcacctgtttcccccacctactccaatatttgctggaggagcaaatgaccggtgggtacgatctgtatcttttagccatgatggactgcatgttgcaagccttgctgatgataaaatggtgaggttctggagaattgatgaggattatccagtgcaagttgcacctttgagcaatggtctttgctgtgccttctctactgatggcagtgttttagctgctgggacacatgacggaagtgtgtatttttgggccactccacggcaggtccctagcctgcaacatttatgtcgcatgtcaatccgaagagtgatgcccacccaagaagttcaggagctgccgattccttccaagcttttggagtttctctcgtatcgtatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fibroblast activation protein, alpha
- retinol binding protein 5, cellular
- ribosomal protein S2 pseudogene
- odontogenic, ameloblast asssociated

Buy WSB1-WD repeat and SOCS box-containing 1 Gene now

Add to cart