Cart 2 Product Products 234,90 € (empty)
-
1 x ALMS1P-Als...113,40 € -
1 x BCDIN3D-BC...121,50 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
Data sheet of ODAM-odontogenic, ameloblast asssociated Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ODAM-odontogenic, ameloblast asssociated Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017796 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ODAM |
| Origin species: | Human |
| Product name: | ODAM-odontogenic, ameloblast asssociated Gene |
| Size: | 2ug |
| Accessions: | BC017796 |
| Gene id: | 54959 |
| Gene description: | odontogenic, ameloblast asssociated |
| Synonyms: | APIN; odontogenic ameloblast-associated protein; odontogenic, ameloblast asssociated |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccctatgtattctccttcaaaatgcctcaagagcaaggacagatgtttcaatactatccagtttacatggtcctaccctgggaacaacctcagcaaacagttccaaggtcacctcaacaaacaagacagcaacagtatgaggagcagataccattctatgctcaatttggatacattccacaactagcagaacctgctatatcaggaggacagcagcaactagcttttgatccccaactaggcacagctcctgaaattgctgtgatgtcaacaggagaagagataccatatttacaaaaagaagcgatcaactttagacatgacagtgcaggagttttcatgccctcaacttcaccaaaacccagcacaaccaatgttttcacttctgctgtagaccaaactattaccccagagctcccagaagagaaggacaagactgacagcctaagggaaccataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polyhomeotic homolog 3 (Drosophila) - schwannomin interacting protein 1 - glutathione peroxidase 8 (putative) - tocopherol (alpha) transfer protein |