Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RBM8A-RNA binding motif protein 8A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RBM8A-RNA binding motif protein 8A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017770 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RBM8A |
| Origin species: | Human |
| Product name: | RBM8A-RNA binding motif protein 8A Gene |
| Size: | 2ug |
| Accessions: | BC017770 |
| Gene id: | 9939 |
| Gene description: | RNA binding motif protein 8A |
| Synonyms: | ribonucleoprotein RBM8A; BOV-1A; BOV-1B; BOV-1C; C1DELq21.1; DEL1q21.1; MDS014; RBM8; RBM8B; TAR; Y14; ZNRP; ZRNP1; RNA-binding protein 8A; BOV-1; RNA binding motif protein 8B; RNA-binding protein Y14; binder of OVCA1-1; ribonucleoprotein RBM8; RNA binding motif protein 8A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggacgtgctagatcttcacgaggctgggggcgaagatttcgccatggatgaggatggggacgagagcattcacaaactgaaagaaaaagcgaagaaacggaagggtcgcggctttggctccggtgagtgtggggaaaatggggtagagtggcctagtagggcaggagctacgggttttggagtccccacccacctcataggaacaatgggagaaaggaggagttttcggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding motif protein 23 - trefoil factor 3 (intestinal) - YME1-like 1 (S. cerevisiae) - AVL9 homolog (S. cerevisiase) |