Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TFF3-trefoil factor 3 (intestinal) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TFF3-trefoil factor 3 (intestinal) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017859 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TFF3 |
| Origin species: | Human |
| Product name: | TFF3-trefoil factor 3 (intestinal) Gene |
| Size: | 2ug |
| Accessions: | BC017859 |
| Gene id: | 7033 |
| Gene description: | trefoil factor 3 (intestinal) |
| Synonyms: | ITF; P1B; TFI; trefoil factor 3; polypeptide P1.B; trefoil factor 3 (intestinal) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctggggctggtcctggccttgctgtcctccagctctgctgaggagtacgtgggcctgtctgcaaaccagtgtgccgtgccagccaaggacagggtggactgcggctacccccatgtcacccccaaggagtgcaacaaccggggctgctgctttgactccaggatccctggagtgccttggtgtttcaagcccctgcaggaagcagaatgcaccttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - YME1-like 1 (S. cerevisiae) - AVL9 homolog (S. cerevisiase) - H2A histone family, member Z - immunoglobulin kappa constant |