CNN3-calponin 3, acidic Gene View larger

CNN3-calponin 3, acidic Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CNN3-calponin 3, acidic Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CNN3-calponin 3, acidic Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025372
Product type: DNA & cDNA
Ncbi symbol: CNN3
Origin species: Human
Product name: CNN3-calponin 3, acidic Gene
Size: 2ug
Accessions: BC025372
Gene id: 1266
Gene description: calponin 3, acidic
Synonyms: calponin-3; calponin 3, acidic; calponin, acidic isoform; dJ639P13.2.2 (acidic calponin 3); calponin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccacttcaacaagggcccttcctatgggctctcggccgaagtcaagaacaagattgcttccaagtatgatcatcaggcagaagaagatcttcgcaattggatagaagaggtgacaggcatgagcattggccccaacttccagctgggcttaaaggatggcatcatcctctgcgaacttataaacaagctacagccaggctcagtgaagaaggtcaacgagtcctcactgaactggcctcagttggagaatattggcaactttattaaagctattcaggcttatggtatgaagccacatgacatattcgaagcaaatgatctttttgagaatggaaacatgacccaggttcagactactctggtggctctagcaggtctggctaaaacaaaaggattccatacaaccattgacattggagttaagtatgcagaaaaacaaacaagacgttttgatgaaggaaaattaaaagctggccaaagtgtaattggtctgcagatgggaaccaacaaatgtgccagccaggcaggtatgacagcttacgggactaggaggcatctttatgatcccaaaatgcaaactgacaaaccttttgaccagaccacaattagtctgcagatgggcactaataaaggagccagccaggcagggatgttagcaccaggtaccagaagagacatctatgatcagaagctaacattacagccggtggacaactcgacaatttccctacagatgggtaccaacaaagttgcttcccagaaaggaatgagtgtgtatgggcttgggcggcaagtatatgatcccaaatactgtgctgctcctacagaacctgtcattcacaacggaagccaaggaacaggaacaaatggttcggaaatcagtgatagtgattatcaggcagaataccctgatgagtatcatggcgagtaccaggatgactaccccagagattaccaatatagcgaccaaggcattgattattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PRO0132 protein
- F-box protein 36
- tubulin, beta 2A
- prothymosin, alpha

Buy CNN3-calponin 3, acidic Gene now

Add to cart