Cart 5 Product Products 583,20 € (empty)
-
1 x ADAMTSL4-A...121,50 € -
1 x CCDC26-coi...113,40 € -
1 x MGC5566-hy...113,40 € -
1 x CXCL5-chem...113,40 € -
1 x ATXN7L3-at...121,50 €
No products
To be determined Shipping
583,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 583,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 583,20 €
Data sheet of PRO0132-PRO0132 protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRO0132-PRO0132 protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020670 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRO0132 |
| Origin species: | Human |
| Product name: | PRO0132-PRO0132 protein Gene |
| Size: | 2ug |
| Accessions: | BC020670 |
| Gene id: | 29034 |
| Gene description: | PRO0132 protein |
| Synonyms: | PRO0132; CPS1-IT; CPS1IT; CPS1IT1; CPS1 intronic transcript 1 (non-protein coding) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctagacgtgggttttctggttccacccttgtgcattggaaggagcagactatggagccagagattggtgcgcagtcctccccactgtagaatcagacgtacatcacctctttcatttctccagattcatgttctttctcttaatctctgcttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - F-box protein 36 - tubulin, beta 2A - prothymosin, alpha - WD repeat domain 3 |