PRO0132-PRO0132 protein Gene View larger

PRO0132-PRO0132 protein Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRO0132-PRO0132 protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRO0132-PRO0132 protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020670
Product type: DNA & cDNA
Ncbi symbol: PRO0132
Origin species: Human
Product name: PRO0132-PRO0132 protein Gene
Size: 2ug
Accessions: BC020670
Gene id: 29034
Gene description: PRO0132 protein
Synonyms: PRO0132; CPS1-IT; CPS1IT; CPS1IT1; CPS1 intronic transcript 1 (non-protein coding)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctagacgtgggttttctggttccacccttgtgcattggaaggagcagactatggagccagagattggtgcgcagtcctccccactgtagaatcagacgtacatcacctctttcatttctccagattcatgttctttctcttaatctctgcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - F-box protein 36
- tubulin, beta 2A
- prothymosin, alpha
- WD repeat domain 3

Buy PRO0132-PRO0132 protein Gene now

Add to cart