ZNF32-zinc finger protein 32 Gene View larger

ZNF32-zinc finger protein 32 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF32-zinc finger protein 32 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF32-zinc finger protein 32 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022842
Product type: DNA & cDNA
Ncbi symbol: ZNF32
Origin species: Human
Product name: ZNF32-zinc finger protein 32 Gene
Size: 2ug
Accessions: BC022842
Gene id: 7580
Gene description: zinc finger protein 32
Synonyms: KOX30; zinc finger protein 32; C2H2-546; zinc finger protein 32 (KOX 30); zinc finger protein KOX30
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttggatttccaacagctaccctgctggactgtcatggaagatatgcccagaatgtagcgttcttcaatgtgatgactgaagcccaccacaaatatgaccactctgaggctacaggatcctcaagctgggatatccaaaattctttcagaagagagaagctggaacaaaaatccccagattcgaagacactacaggaagattcacctggagtgagacaaagggtctatgagtgccaggagtgtggaaaatccttccggcaaaaaggtagtctaacgttacatgagagaatccacactggtcaaaagccttttgagtgcacccactgtggaaaaagcttcagggccaaaggcaatcttgttacacatcaacggatacacacgggagagaagccttatcagtgcaaggagtgtgggaaaagcttcagtcaacgaggtagtctcgctgtccacgagagactccacactggacagaaaccctacgagtgtgctatttgtcagagaagcttcaggaatcagagtaaccttgctgttcacaggagagttcacagtggtgagaagccctatagatgtgatcagtgtggaaaagccttcagtcagaaaggaagcttaattgttcacatcagagtccacacaggcctgaagccctatgcctgtacccagtgcaggaagagtttccacaccagggggaattgtattctgcatggcaaaatccacacaggagagacaccctatctgtgcggccagtgtggaaaaagcttcacccagagagggagtctggctgtgcaccagcgaagctgctcacagaggctcaccctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SH2 domain protein 1A
- ankyrin 1, erythrocytic
- zinc finger protein 69
- SET binding protein 1

Buy ZNF32-zinc finger protein 32 Gene now

Add to cart