Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SH2D1A-SH2 domain protein 1A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SH2D1A-SH2 domain protein 1A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020732 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SH2D1A |
| Origin species: | Human |
| Product name: | SH2D1A-SH2 domain protein 1A Gene |
| Size: | 2ug |
| Accessions: | BC020732 |
| Gene id: | 4068 |
| Gene description: | SH2 domain protein 1A |
| Synonyms: | SAP/SH2D1A; DSHP; EBVS; IMD5; LYP; MTCP1; SAP; XLP; XLPD; XLPD1; SH2 domain-containing protein 1A; Duncan disease SH2-protein; SLAM associated protein/SH2 domain protein 1A; SLAM-associated protein; T cell signal transduction molecule SAP; signaling lymphocyte activation molecule-associated protein; signaling lymphocytic activation molecule-associated protein; SH2 domain containing 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgcagtggctgtgtatcatggcaaaatcagcagggaaaccggcgagaagctcctgcttgccactgggctggatggcagctatttgctgagggacagcgagagcgtgccaggcgtgtactgcctatgtgtgctgtatcacggttacatttatacataccgagtgtcccagacagaaacaggttcttggagtgctgagacagcacctggggtacataaaagatatttccggaaaataaaaaatctcatttcagcatttcagaagccagatcaaggcattgtaatacctctgcagtatccagttgagaagaagtcctcagctagaagtacacaaggtactacagggataagagaagatcctgatgtctgcctgaaagccccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ankyrin 1, erythrocytic - zinc finger protein 69 - SET binding protein 1 - lactate dehydrogenase A |