39696-septin 5 Gene View larger

39696-septin 5 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of 39696-septin 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about 39696-septin 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025261
Product type: DNA & cDNA
Ncbi symbol: 39696
Origin species: Human
Product name: 39696-septin 5 Gene
Size: 2ug
Accessions: BC025261
Gene id: 5413
Gene description: septin 5
Synonyms: septin 5; CDCREL; CDCREL-1; CDCREL1; HCDCREL-1; PNUTL1; septin-5; cell division control related protein 1; peanut-like 1; platelet glycoprotein Ib beta chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcacaggcctgcggtacaagagcaagctggcgaccccagaggacaagcaggacattgacaagcagtacgtgggcttcgccacactgcccaaccaggtgcaccgcaagtcggtgaagaaaggctttgacttcacactcatggtggctggtgagtcaggcctggggaagtccacactggtccacagcctcttcctgacagacttgtacaaggaccggaagctgctcagtgctgaggagcgcatcagccagacggtagagattctaaaacacacggtggacattgaggagaagggagtcaagctgaagctcaccatcgtggacacgccgggattcggggacgctgtcaacaacaccgagtgctggaagcccatcaccgactatgtggaccagcagtttgagcagtacttccgtgatgagagcggcctcaaccgaaagaacatccaagacaaccgagtgcactgctgcctatacttcatctcccccttcgggcatgggctgcggccagtggatgtgggtttcatgaaggcattgcatgagaaggtcaacatcgtgcctctcatcgccaaagctgactgtcttgtccccagtgagatccggaagctgaaggagcggatccgggaggagattgacaagtttgggatccatgtataccagttccctgagtgtgactcggacgaggatgaggacttcaagcagcaggaccgggaactgaaggagagcgcgcccttcgccgttataggcagcaacacggtggtggaggccaaggggcagcgggtccggggccgactgtacccctgggggatcgtggaggtggagaaccaggcgcattgcgacttcgtgaagctgcgcaacatgctcatccgcacgcatatgcacgacctcaaggacgtgacgtgcgacgtgcactacgagaactaccgcgcgcactgcatccagcagatgaccagcaaactgacccaggacagccgcatggagagccccatcccgatcctgccgctgcccaccccggacgccgagactgagaagcttatcaggatgaaggatgaggaactgaggcgcatgcaggagatgctgcagaggatgaagcagcagatgcaggaccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serglycin
- endomucin
- clarin 3
- haptoglobin

Buy 39696-septin 5 Gene now

Add to cart