Cart 32 Product Products 7 857,24 € (empty)
-
1 x HAS3-hyalu...121,50 € -
1 x SLC35F1-so...121,50 € -
-
1 x ATP6V0C-AT...113,40 € -
1 x ATM-ataxia...113,40 € -
1 x MRS2-MRS2...121,50 € -
-
1 x F8-coagula...113,40 € -
1 x TNFRSF12A-...113,40 € -
1 x RPL14-ribo...113,40 € -
1 x CLSTN3-cal...121,50 € -
-
-
-
-
1 x IGFBP4-ins...113,40 € -
1 x MCART1-mit...121,50 € -
1 x NDUFC2-NAD...113,40 € -
1 x IL1F7-inte...113,40 € -
1 x DMKN-dermo...121,50 € -
1 x SPIN4-spin...113,40 € -
-
-
1 x EGR2-early...121,50 € -
1 x PTK6-PTK6...121,50 € -
-
-
-
1 x RPRD1B-reg...121,50 € -
1 x C21orf34-c...113,40 € -
1 x CSHL1-chor...113,40 € -
No products
To be determined Shipping
7 857,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 32 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 857,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 857,24 €
Data sheet of HP-haptoglobin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HP-haptoglobin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058031 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HP |
| Origin species: | Human |
| Product name: | HP-haptoglobin Gene |
| Size: | 2ug |
| Accessions: | BC058031 |
| Gene id: | 3240 |
| Gene description: | haptoglobin |
| Synonyms: | HP2ALPHA2; HPA1S; binding peptide; haptoglobin alpha(1S)-beta; haptoglobin alpha(2FS)-beta; haptoglobin, alpha polypeptide; haptoglobin, beta polypeptide; zonulin |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtttcccaccataatctcaccacaggtgccacgctgatcaatgaacaatggctgctgaccacggctaaaaatctcttcctgaaccattcagaaaatgcaacagcgaaagacattgcccctactttaacactctatgtggggaaaaagcagcttgtagagattgagaaggttgttctacaccctaactactcccaggtagatattgggctcatcaaactcaaacagaaggtgtctgttaatgagagagtgatgcccatctgcctaccttcaaaggattatgcagaagtagggcgtgtgggttatgtttctggctgggggcgaaatgccaattttaaatttactgaccatctgaagtatgtcatgctgcctgtggctgaccaagaccaatgcataaggcattatgaaggcagcacagtccccgaaaagaagacaccgaagagccctgtaggggtgcagcccatactgaatgaacacaccttctgtgctggcatgtctaagtaccaagaagacacctgctatggcgatgcgggcagtgcctttgccgttcacgacctggaggaggacacctggtatgcgactgggatcttaagctttgataagagctgtgctgtggctgagtatggtgtgtatgtgaaggtgacttccatccaggactgggttcagaagaccatagctgagaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - epiphycan - keratin 4 - lacritin - fetuin B |