HEXIM2-hexamthylene bis-acetamide inducible 2 Gene View larger

HEXIM2-hexamthylene bis-acetamide inducible 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HEXIM2-hexamthylene bis-acetamide inducible 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HEXIM2-hexamthylene bis-acetamide inducible 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025970
Product type: DNA & cDNA
Ncbi symbol: HEXIM2
Origin species: Human
Product name: HEXIM2-hexamthylene bis-acetamide inducible 2 Gene
Size: 2ug
Accessions: BC025970
Gene id: 124790
Gene description: hexamthylene bis-acetamide inducible 2
Synonyms: protein HEXIM2; MAQ1 paralog; hexamethylene bis-acetamide inducible 2; hexamethylene bis-acetamide-inducible protein 2; hexamethylene-bis-acetamide-inducible transcript 2; hexamethylene bisacetamide inducible 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggccactccgaaccagaccgcctgtaatgcagagtcaccagtggccctggaggaggccaagacctctggtgccccggggagcccccaaacaccccctgagcgtcatgactctggtggttccctgcccctgacaccgcggatggagagccactcagaggatgaagatcttgctggggctgtcggtggcctgggctggaacagtaggagtccccggacccagagcccagggggctgctcagcggaggctgtgctggcccggaagaaacaccgtcggcggccatcgaagcgcaaaaggcactggcgaccctacctggagctgagctgggctgagaaacaacagcgggatgagaggcagagccagagggcctcccgggtccgcgaagagatgttcgccaaaggccagcccgtggccccctacaacaccacccagttcctgatgaatgacagggacccggaggagcccaacttggatgtgccccatgggatctcccacccaggttccagtggggagagtgaggccggggacagtgatgggcggggccgagcgcacggtgagttccagcggaaggacttctctgagacttacgaacgcttccacaccgagagcctgcagggccgcagcaagcaggagctggtgcgagactacctggagctggagaagcggctgtcgcaggcggaggaggagactaggaggctgcagcagctgcaggcgtgcaccggccagcagtcctgccgccaggtggaggagctggctgccgaggtccagaggctccggaccgaaaaccagcggcttcgtcaggagaaccagatgtggaaccgagagggctgccgctgtgatgaggagccgggtacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NOP14 nucleolar protein homolog (yeast)
- teratocarcinoma-derived growth factor 1
- U2 small nuclear RNA auxiliary factor 1
- leptin receptor overlapping transcript

Buy HEXIM2-hexamthylene bis-acetamide inducible 2 Gene now

Add to cart