EVL-Enah/Vasp-like Gene View larger

EVL-Enah/Vasp-like Gene

PTXBC023997

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EVL-Enah/Vasp-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EVL-Enah/Vasp-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023997
Product type: DNA & cDNA
Ncbi symbol: EVL
Origin species: Human
Product name: EVL-Enah/Vasp-like Gene
Size: 2ug
Accessions: BC023997
Gene id: 51466
Gene description: Enah/Vasp-like
Synonyms: RNB6; ena/VASP-like protein; ena/vasodilator-stimulated phosphoprotein-like; Enah/Vasp-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgaacagagtatctgccaagcccgggcttccgtgatggtctacgatgacaccagtaagaaatgggtaccaatcaaacctggccagcagggattcagccggatcaacatctaccacaacactgccagcaacaccttcagagtcgttggagtcaagttgcaggatcagcaggttgtgatcaattattcaatcgtgaaagggctgaagtacaatcaggccacgccaaccttccaccagtggcgagatgcccgccaggtctacggcttaaactttgcaagtaaagaagaggcaaccacgttctccaatgcaatgctgtttgccctgaacatcatgaattcccaagaaggaggcccctccagccagcgtcaggtgcagaatggcccctctcctgatgagatggacatccagagaagacaagtgatggagcagcaccagcagcagcgtcaggaatctctagaaagaagaacctcggccacagggcccatcctcccaccaggacatccttcatctgcagccagcgcccccgtctcatgtagtgggcctccaccgccccccccacccccagtcccacctccacccactggggctaccccacctcccccacccccactgccagccggaggagcccaggggtccagccacgacgagagctccatgtcaggactggccgctgccatagctggggccaagctgagaagagtccaacggccagaagacgcatctggaggctccagtcccagtgggacctcaaagtccgatgccaaccgggcaagcagcgggggtggcggaggaggcctcatggaggaaatgaacaaactgctggccaagaggagaaaagcagcctcccagtcagacaagccagccgagaagaaggaagatgaaagccaaatggaagatcctagtacctccccctctccggggacccgagcagccagccagccacctaactcctcagaggctggccggaagccctgggagcggagcaactcggtggagaagcctgtgtcctcgattctgtccagaaccccgtctgtggcaaagagccccgaagctaagagcccccttcagtcgcagcctcactctaggatgaagcctgctgggagcgtgaatgacatggccctggatgccttcgacttggaccggatgaagcaggagatcctagaggaggtggtgagagagctccacaaggtgaaggaggagatcatcgacgccatcaggcaggagctgagtgggatcagcaccacgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kazrin
- glycophorin E
- orosomucoid 1
- CD96 molecule

Buy EVL-Enah/Vasp-like Gene now

Add to cart