RP1-21O18.1-kazrin Gene View larger

RP1-21O18.1-kazrin Gene

PTXBC035501

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RP1-21O18.1-kazrin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RP1-21O18.1-kazrin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035501
Product type: DNA & cDNA
Ncbi symbol: RP1-21O18.1
Origin species: Human
Product name: RP1-21O18.1-kazrin Gene
Size: 2ug
Accessions: BC035501
Gene id: 23254
Gene description: kazrin
Synonyms: KAZ; kazrin; kazrin, periplakin interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggagatgttggcgaaggacctggaggagtcgcagggcggcaagtcctctgaggtcctctcggccaccgagctcagggtccagctggcccagaaggagcaggagctagccagagccaaagaagccttgcaggccatgaaagctgatcggaagcgcttaaagggcgagaagacagacctggtgagccagatgcagcagctgtatgccacactggagagccgcgaggagcagctccgagacttcatccgcaactatgagcagcaccgcaaggagagcgaggatgcggtcaaagcgctggccaaggagaaggacctgctggagcgtgagaagtgggagctgcggcgccaagccaaggaggccacagaccacgccacggcactgcgctcccagctggacctcaaggacaaccggatgaaggagctggaggccgagctggccatggccaaacagtccttagctacgctgaccaaggacgtccccaagcggcattccctcgccatgccgggcgagacggtgctcaatggcaaccaggagtgggtggtgcaggcggacctcccgctgaccgcagccatccggcagagtcaacagactctctaccactcacacccccctcaccctgcggaccggcaagcggtcagggtgagcccctgccactcccggcagccctctgtcatctccgacgcatctgccgccgaaggcgaccggtcgtccacaccgagcgacatcaactcccctcgacaccggacacactccctctgcaacggcgacagtcccggcccagttcagaagaacctgcacaaccctattgtacagtcactagaggatcttgaagaccaaaaacggaaaaagaagaaagagaagatgggattcggctccatctcccgcgtcttcgccagagggaagcagcggaagtccctcgaccccggcctctttgatggtaccgcccctgattattacatagaggaggacgcggactggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glycophorin E
- orosomucoid 1
- CD96 molecule
- ubiquilin 1

Buy RP1-21O18.1-kazrin Gene now

Add to cart