PTXBC032128
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032128 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DDX39 |
| Origin species: | Human |
| Product name: | DDX39-DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene |
| Size: | 2ug |
| Accessions: | BC032128 |
| Gene id: | 10212 |
| Gene description: | DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 |
| Synonyms: | DDX39; BAT1; BAT1L; DDXL; URH49; ATP-dependent RNA helicase DDX39A; DEAD (Asp-Glu-Ala-Asp) box polypeptide 39; DEAD (Asp-Glu-Ala-Asp) box polypeptide 39A; DEAD box protein 39; DEAD-box helicase 39A; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39; UAP56-related helicase, 49 kDa; nuclear RNA helicase URH49; nuclear RNA helicase, DECD variant of DEAD box family; DExD-box helicase 39A |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagaacaggatgtggaaaacgatcttttggattacgatgaagaggaagagccccaggctcctcaagagagcacaccagctccccctaagaaagacatcaagggatcctacgtttccatccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgtggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcctgggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtcttcgtgctggccaccctacagcagattgagcctgtcaacggacaggtgacggtcctggtcatgtgccacacgagggagctggccttccagatcagcaaggaatatgagcgcttttccaagtacatgcccagcgtcaaggtgtctgtgttcttcggtggtctctccatcaagaaggatgaagaagtgttgaagaagaactgtccccatgtcgtggtggggaccccgggccgcatcctggcgctcgtgcggaataggagcttcagcctaaagaatgtgaagcactttgtgctggacgagtgtgacaagatgctggagcagctggacatgcggcgggatgtgcaggagatcttccgcctgacaccacacgagaagcagtgcatgatgttcagcgccaccctgagcaaggacatccggcctgtgtgcaggaagttcatgcaggatcccatggaggtgtttgtggacgacgagaccaagctcacgctgcacggcctgcagcagtactacgtcaaactcaaagacagtgagaagaaccgcaagctctttgatctcttggatgtgctggagtttaaccagcctgtcacgctatcagcagttcaaggatttccagcggcggatcctggtggccaccaatctgtttggccgggggatggacatcgagcgagtcaacatcgtctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - F-box and leucine-rich repeat protein 18 - elongation factor RNA polymerase II-like 3 - DEAH (Asp-Glu-Ala-His) box polypeptide 15 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 |