ELL3-elongation factor RNA polymerase II-like 3 Gene View larger

ELL3-elongation factor RNA polymerase II-like 3 Gene

PTXBC006548

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELL3-elongation factor RNA polymerase II-like 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ELL3-elongation factor RNA polymerase II-like 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006548
Product type: DNA & cDNA
Ncbi symbol: ELL3
Origin species: Human
Product name: ELL3-elongation factor RNA polymerase II-like 3 Gene
Size: 2ug
Accessions: BC006548
Gene id: 80237
Gene description: elongation factor RNA polymerase II-like 3
Synonyms: RNA polymerase II elongation factor ELL3; elongation factor RNA polymerase II-like 3; elongation factor for RNA polymerase II 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagctccaggagcctctgagaggacagctccggctctgcttcacgcaagctgcccggactagcctcttactgctcaggctcaacgacgctgccctgcgggcgctgcaagagtgtcagcggcaacaggtacggccggtgattgctttccaaggccaccgagggtatctgagactcccaggccctggttggtcctgcctcttctccttcatagtgtcccagtgttgtcaggagggcgctggtggtagcttggaccttgtgtgccaacgcttcctcaggtctgggcctaacagcctccactgcctgggctcactcagggagcgcctcattatttgggcagccatggattctatcccagccccatcatcagttcagggacacaacctgactgaagatgccagacatcctgagagttggcagaacacaggaggctattctgaaggagatgcagtatcacagccacagatggcactagaggaggtgtcagtgtcagatccactggcaagcaaccaaggacagtcactcccaggatcctcaagggagcacatggcacagtgggaagtgagaagccagacccatgttccaaacagagaacctgttcaggcactgccttcctctgccagccggaaacgtctggacaagaaacgttcagtgcctgtagccactgtagaactggaagaaaagaggttcagaactctgcctttagtgccaagccccctacaaggcctgaccaatcaggatttacaagagggagaagattgggagcaagaagatgaggacatggaccccagattagaacacagttcctcagttcaagaagattctgaatccccaagtcctgaagatataccagactacctcctgcaatacagggccatccacagtgcagaacagcaacatgcctatgagcaggactttgagacagattatgctgaataccgcatcctgcatgcccgtgttgggactgcaagccaaaggttcatagagctgggagcagagattaaaagagttcggcgaggaactccagaatacaaggtcctggaagacaagataatccaggaatataaaaagttcaggaagcagtacccaagttacagagaagaaaagcgtcgctgtgagtaccttcaccagaaattgtcccacattaaaggtctcatcctggagtttgaggaaaagaacaggggcagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DEAH (Asp-Glu-Ala-His) box polypeptide 15
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
- methyltransferase 5 domain containing 1
- pregnancy specific beta-1-glycoprotein 11

Buy ELL3-elongation factor RNA polymerase II-like 3 Gene now

Add to cart