PTXBC018778
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018778 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KDELR1 |
| Origin species: | Human |
| Product name: | KDELR1-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 Gene |
| Size: | 2ug |
| Accessions: | BC018778 |
| Gene id: | 10945 |
| Gene description: | KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 |
| Synonyms: | ERD2; ERD2.1; HDEL; PM23; ER lumen protein-retaining receptor 1; KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1; KDEL receptor 1; KDEL endoplasmic reticulum protein retention receptor 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatctcttccgattcctgggagacctctcccacctcctcgccatcatcttgctactgctcaaaatctggaagtcccgctcgtgcgccggaatttcagggaagagccaggtcctgtttgctgtggtgttcactgcccgatatctggacctcttcaccaactacatctcactctacaacacgtgtatgaaggtggtctacatagcctgctccttcaccacggtctggttgatttatagcaagttcaaagctacttacgatgggaaccatgacacgttcagagtggagttcctggtcgttcccacagccattctggcgttcctggtcaatcatgacttcacccctctggagatcctctggaccttctccatctacctggagtcagtggccatcttgccgcagctgttcatggtgagcaagaccggcgaggcggagaccatcaccagccactacttgtttgcgctaggcgtttaccgcacgctctatctcttcaactggatctggcgctaccatttcgagggcttcttcgacctcatcgccattgtggcaggcctggtccagacagtcctctactgcgatttcttctacctctatatcaccaaagtcctaaaggggaagaagttgagtttgccggcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform - microtubule associated monoxygenase, calponin and LIM domain containing 1 - CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae) - microtubule associated monoxygenase, calponin and LIM domain containing 1 |