Login to display prices
Login to display prices
PPP2R2A-protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform Gene View larger

PPP2R2A-protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform Gene

PTXBC041071

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP2R2A-protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPP2R2A-protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform Gene

Proteogenix catalog: PTXBC041071
Ncbi symbol: PPP2R2A
Product name: PPP2R2A-protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform Gene
Size: 2ug
Accessions: BC041071
Gene id: 5520
Gene description: protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform
Synonyms: B55A; B55ALPHA; PR52A; PR55A; serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform; protein phosphatase 2, regulatory subunit B, alpha; protein phosphatase 2 regulatory subunit Balpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggagctggaggagggaatgatattcagtggtgtttttctcaggtgaaaggagcagtagatgatgatgtagcagaagcagatataatttctacagtagaatttaatcattctggagaattactagcaacaggagataaaggtggtagagttgtcatctttcaacaggagcaggagaacaaaatccagtctcatagcagaggagaatataatgtttacagcaccttccagagccatgaaccagagtttgactacttgaaaagtttagaaatagaagaaaagatcaacaaaattaggtggttaccccagaaaaatgctgctcagtttttattgtctaccaatgataaaacaataaaattatggaaaatcagtgaaagggacaaaagaccagaagggtataacttgaaagaggaggatggaaggtatagagatcctactacagttactacactacgagtgccagtctttaggcctatggatctaatggttgaggccagtccacgaagaatatttgccaatgctcatacatatcacatcaactcaatttctattaatagtgattatgaaacatatttatctgcagatgatttgcggattaatctttggcatctggaaattacagacaggagttttaacattgtggatatcaagcctgccaatatggaagagctaacagaggtgattacagcagcagaatttcatccaaacagctgtaacacatttgtatacagcagcagtaaaggaactattcggctatgtgacatgagggcatctgccctctgtgatagacattctaaattgtttgaagaacctgaagatcccagtaacaggtcatttttttccgaaatcatctcctctatttcggatgtaaaattcagccatagtggtcgatatatgatgactagagactatttgtcagtcaaaatttgggacttaaatatggaaaacaggcctgtggaaacataccaggtgcatgaatacctcagaagtaaactctgttcactgtatgaaaatgactgcatatttgacaaatttgaatgttgttggaatggatctgacagtgttgtcatgactggatcttacaataatttcttcagaatgtttgacagaaacacaaagcgagacataaccctagaagcatcgcgggaaaacaataagcctcgcacagttctgaagcctcgcaaagtctgtgcaagtggcaagcgaaagaaagatgaaataagtgttgacagcctagacttcaataagaaaatccttcacacagcctggcaccccaaggaaaatatcattgccgtagctactacaaacaatctgtatatatttcaagacaaagtgaattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: