Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GFER-growth factor, augmenter of liver regeneration Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GFER-growth factor, augmenter of liver regeneration Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028348 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GFER |
| Origin species: | Human |
| Product name: | GFER-growth factor, augmenter of liver regeneration Gene |
| Size: | 2ug |
| Accessions: | BC028348 |
| Gene id: | 2671 |
| Gene description: | growth factor, augmenter of liver regeneration |
| Synonyms: | ALR; ERV1; HERV1; HPO; HPO1; HPO2; HSS; FAD-linked sulfhydryl oxidase ALR; ERV1 homolog; erv1-like growth factor; hepatic regenerative stimulation substance; hepatopoietin protein; growth factor, augmenter of liver regeneration |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggacgcagcagaagcgggacaccaagtttagggaggactgcccgccggatcgcgaggaactgggccgccacagctgggctgtcctccacaccctggccgcctactaccccgacctgcccaccccagaacagcagcaagacatggcccagttcatacatttattttctaagttttacccctgtgaggagtgtgctgaagacctaagaaaaaggctgtgcaggaaccacccagacacccgcacccgggcatgcttcacacagtggctgtgccacctgcacaatgaagtgaaccgcaagctgggcaagcctgacttcgactgctcaaaagtggatgagcgctggcgcgacggctggaaggatggctcctgtgactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - peptidylprolyl isomerase (cyclophilin)-like 5 - family with sequence similarity 58, member A - family with sequence similarity 57, member A - phenylalanyl-tRNA synthetase 2, mitochondrial |