PTXBC030142
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030142 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPIL5 |
| Origin species: | Human |
| Product name: | PPIL5-peptidylprolyl isomerase (cyclophilin)-like 5 Gene |
| Size: | 2ug |
| Accessions: | BC030142 |
| Gene id: | 122769 |
| Gene description: | peptidylprolyl isomerase (cyclophilin)-like 5 |
| Synonyms: | PPIL5; 4-1BBLRR; LRR-1; leucine-rich repeat protein 1; 4-1BB-mediated signaling molecule; LRR-repeat protein 1; cyclophilin-like 5; peptidylprolyl isomerase (cyclophilin)-like 5; peptidylprolyl isomerase-like 5; leucine rich repeat protein 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagctacactgtgaggtggaggtgatcagccggcacttgcccgccttggggcttaggaaccggggcaagggcgtccgagccgtgttgagcctctgtcagcagacttccaggagtcagccgccggtccgagccttcctgctcatctccaccctgaaggacaagcgcgggacccgctatgagctaagggagaacattgagcaattcttcaccaaatttgtagatgaggggaaagccactgttcggttaaaggagcctcctgtggatatctgtctaagtaaggattccatatggctctcatatcattccattccatctctgccaagatttggataccgcaaaaatttgtgtttgtggaagattctgtctgaactctttcattcaaggaactactaccatgaatctgcattctgttgcccacactgtggtcttagtagataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 58, member A - family with sequence similarity 57, member A - phenylalanyl-tRNA synthetase 2, mitochondrial - family with sequence similarity 43, member A |