Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 159,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 159,00 €
Data sheet of JAGN1-jagunal homolog 1 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about JAGN1-jagunal homolog 1 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032101 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | JAGN1 |
| Origin species: | Human |
| Product name: | JAGN1-jagunal homolog 1 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC032101 |
| Gene id: | 84522 |
| Gene description: | jagunal homolog 1 (Drosophila) |
| Synonyms: | GL009; SCN6; protein jagunal homolog 1; jagunal homolog 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtctcgagcaggcccgcgagcggccggcaccgacggcagcgactttcagcaccgggagcgcgtcgccatgcactaccagatgagtgtgaccctcaagtatgaaatcaagaagctgatctacgtacatctggtcatatggctgctgctggttgctaagatgagcgtgggacacctgaggctcttgtcacatgatcaggtggccatgccctatcagtgggaatacccgtatttgctgagcattttgccctctctcttgggccttctctcctttccccgcaacaacattagctacctggtgctctccatgatcagcatgggactcttttccatcgctccactcatttatggcagcatggagatgttccctgctgcacagcagctctaccgccatggcaaggcctaccgtttcctctttggtttttctgccgtttccatcatgtacctggtgttggtgttggcagtgcaagtgcatgcctggcagttgtactacagcaagaagctcctagactcttggttcaccagcacacaggagaagaagcataaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TGFB-induced factor homeobox 2 - upstream transcription factor 1 - ATP-grasp domain containing 1 - HIG1 domain family, member 1B |