Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIGD1B-HIG1 domain family, member 1B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIGD1B-HIG1 domain family, member 1B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020667 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIGD1B |
| Origin species: | Human |
| Product name: | HIGD1B-HIG1 domain family, member 1B Gene |
| Size: | 2ug |
| Accessions: | BC020667 |
| Gene id: | 51751 |
| Gene description: | HIG1 domain family, member 1B |
| Synonyms: | CLST11240; CLST11240-15; HIG1 domain family member 1B; HIG1 hypoxia inducible domain family member 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgctaacagacgctggtgggtaccacctgacgacgaagactgtgtgtctgagaagctcctgaggaagactcgggaatctccactggtgcctataggcttaggaggctgcttggtggtagcagcatacaggatttaccggctgaggtctcgtggttccaccaagatgtccatacacctgattcacacccgagtggcagcgcaggcctgtgcagtgggtgcaatcatgctaggtgctgtgtacacaatgtacagcgattacgtcaagaggatggcacaggatgctggagagaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding motif protein 35B - hypothetical protein HSPC152 - interleukin 1 receptor-like 1 - recombination activating gene 2 |