> >>ZNHIT1-zinc finger, HIT type 1 Gene
ZNHIT1-zinc finger, HIT type 1 Gene View larger

ZNHIT1-zinc finger, HIT type 1 Gene

PTXBC017333

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of ZNHIT1-zinc finger, HIT type 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNHIT1-zinc finger, HIT type 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017333
Product type: DNA & cDNA
Ncbi symbol: ZNHIT1
Origin species: Human
Product name: ZNHIT1-zinc finger, HIT type 1 Gene
Size: 2ug
Accessions: BC017333
Gene id: 10467
Gene description: zinc finger, HIT type 1
Synonyms: CG1I; ZNFN4A1; zinc finger HIT domain-containing protein 1; H_DJ0747G18.14; cyclin-G1-binding protein 1; p18 Hamlet; p18Hamlet; zinc finger protein subfamily 4A member 1; zinc finger protein, subfamily 4A (HIT domain containing), member 1; zinc finger, HIT domain containing 1; zinc finger, HIT type 1; zinc finger HIT-type containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggagaagaaaacttcggttcgctcccaggaccccgggcagcggcgggtgctggaccgggctgcccggcagcgtcgcatcaaccggcagctggaggccctggagaatgacaacttccaggatgacccccacgcgggactccctcagctcggcaagagactgcctcagtttgatgacgatgcggacactggaaagaaaaagaagaaaacccgaggtgatcattttaaacttcgcttccgaaaaaactttcaggccctgttggaggagcagaacttgagtgtggccgagggccctaactacctgacggcctgtgcgggacccccatcgcggccccagcgccccttctgtgctgtctgtggcttcccatccccctacacctgtgtcagctgcggtgcccggtactgcactgtgcgctgtctggggacccaccaggagaccaggtgtctgaagtggactgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - high-mobility group 20B
- FtsJ homolog 1 (E. coli)
- vaccinia related kinase 3
- zinc finger protein 187

Reviews

Buy ZNHIT1-zinc finger, HIT type 1 Gene now

Add to cart