VRK3-vaccinia related kinase 3 Gene View larger

VRK3-vaccinia related kinase 3 Gene

PTXBC023556

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VRK3-vaccinia related kinase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VRK3-vaccinia related kinase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023556
Product type: DNA & cDNA
Ncbi symbol: VRK3
Origin species: Human
Product name: VRK3-vaccinia related kinase 3 Gene
Size: 2ug
Accessions: BC023556
Gene id: 51231
Gene description: vaccinia related kinase 3
Synonyms: serine/threonine-protein pseudokinase VRK3; serine/threonine-protein kinase VRK3; inactive serine/threonine-protein kinase VRK3; vaccinia related kinase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatctccttctgtccagactgtggcaaaagtatccaagcggcattcaaattctgcccctactgtggaaattctttgcctgtagaggagcatgtagggtcccagacctttgtcaatccacatgtgtcatccttccaaggctcaaagagagggctgaactccagttttgaaacctctcctaagaaagtgaaatggtccagcaccgtcacctctccccgattatccctcttctcagatggtgacagttctgagtctgaagatactctgagttcctctgagagatccaaaggctccgggagcagacccccaacccccaaaagcagccctcagaagaccaggaagagccctcaggtgaccaggggtagccctcagaagaccagctgtagccctcagaagaccaggcagagccctcagacgctgaagcggagccgagtgaccacctcacttgaagctttgcccacagggacagtgctgacagacaagagtgggcgacagtggaagctgaagtccttccagaccagggacaaccagggcattctctatgaagctgcacccacctccaccctcacctgtgactcaggaccacagaagcaaaagttctcactcaaactggatgccaaggatgggcgcttgttcaatgagcagaacttcttccagcgggccgccaagcctctgcaagtcaacaagtggaagaagctgtactcgaccccactgctggccatccctacctgcatgggtttcggtgttcaccaggacaaatacaggttcttggtgttacccagcctggggaggagccttcagtcggccctggatgtcagcccaaagcatgtgctgtcagagaggtctgtgctgcaggtggcctgccggctgctggatgccctggagttcctccatgagaatgagtatgttcatggaaatgtgacagctgaaaatatctttgtggatccagaggaccagagtcaggtgactttggcaggctatggcttcgccttccgctattgcccaagtggcaaacacgtggcctacgtggaaggcagcaggagccctcacgagggggaccttgagttcattagcatggacctgcacaagggatgcgggccctcccgccgcagcgacctccagagcctgggctactgcatgctgaagtggctctacgggtttctgccatggacaaattgccttcccaacactgaggacatcatgaagcaaaaacagaagttgccttgggattcattttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 187
- FtsJ homolog 3 (E. coli)
- zinc finger protein 226
- zinc finger protein 239

Buy VRK3-vaccinia related kinase 3 Gene now

Add to cart